НАЦІОНАЛЬНА АКАДЕМІЯ НАУК УКРАЇНИ

ІНСТИТУТ МІКРОБІОЛОГІЇ І ВІРУСОЛОГІЇ ім. Д.К. ЗАБОЛОТНОГО

ЛАЩЕВСЬКИЙ ВАЛЕНТИН ВАЛЕРІЙОВИЧ

УДК 576.85:576.8.078:575.173

Нові підходи до ідентифікації молочнокислих бактерій

03.00.07 – мікробіологія

Автореферат

дисертації на здобуття наукового ступеня

кандидата біологічних наук

КИЇВ – 2005

Дисертація є рукопис.

Робота виконана у відділі фізіології промислових мікроорганізмів
Інституту мікробіології і вірусології ім. Д.К. Заболотного НАН України.

Науковий керівник: Коваленко Надія Костянтинівна, д.б.н., професор,
чл.-кор. НАНУ, Інститут мікробіології і вірусології ім. Д.К. Заболотного
НАН України, провідний науковий співробітник відділу фізіології
промислових мікроорганізмів

Офіційні опоненти: Товкач Федір Іванович, д.б.н., Інститут мікробіології
і вірусології ім. Д.К. Заболотного НАН України, завідувач відділу
молекулярної біології вірусів

Козировська Наталія Олексіївна, к.б.н., Інститут молекулярної біології і
генетики НАН України, старший науковий співробітник відділу регуляторних
механізмів клітини

Провідна установа: Національний медичний університет імені О.О.
Богомольця МОЗ України, кафедра мікробіології, вірусології та
імунології, м. Київ

Захист відбудеться “18” жовтня 2005 р. о 10.00 годині на засіданні
спеціалізованої вченої ради Д 26.233.01 по захисту докторських
дисертацій при Інституті мікробіології і вірусології ім. Д.К.
Заболотного НАН України за адресою: Д03680, Київ, МСП, вул. Заболотного,
154.

З дисертацією можна ознайомитись у бібліотеці Інституту мікробіології і
вірусології ім. Д.К. Заболотного НАН України за адресою: Д03680, Київ,
МСП, вул. Заболотного, 154.

Автореферат дисертації розіслано “ 16 “ вересня 2005 р.

Вчений секретар

спеціалізованої вченої ради,

кандидат біологічних наук,

старший науковий співробітник Пуріш Л.М.

ЗАГАЛЬНА ХАРАКТЕРИСТИКА РОБОТИ

Актуальність проблеми. В даний час класифікація молочнокислих бактерій
привертає до себе постійно зростаючу увагу науковців. Це пов’язано,
насамперед, із широким розповсюдженням цієї групи мікроорганізмів у
природі і тією важливою роллю, яку вони відіграють у житті людини і
тварин. Молочнокислі бактерії досить різні за своїми властивостями.
Переважно це обумовлено їхньою специфічною здатністю адаптуватися до
умов навколишнього середовища. Гетерогенність їх властивостей створює
значні труднощі при ідентифікації даної групи мікроорганізмів.
Використання деяких генотипових методів: вміст GC-пар, використання
методу полімеразної ланцюгової реакції (ПЛР), аналіз гена 16S рРНК і
ін., поряд із класичними мікробіологічними, призвело до опису багатьох
нових видів, таких як Lactobacillus pantheri, L. thermotolerans, L.
jaguar та ін., назва яких іноді походить тільки від джерела виділення
бактерій. Разом з тим, часто виявляються штами, які важко віднести до
того або іншого виду, підвиду тому, що вони займають проміжне положення
за своїми властивостями. Тому необхідно розробити чітку схему
ідентифікації молочнокислих бактерій із залученням фенотипових і нових
генотипових ознак, що дозволить у значній мірі вдосконалити
ідентифікацію даної групи мікроорганізмів. Для виконання цієї задачі
необхідно використовувати нові методи вивчення властивостей
молочнокислих бактерій, які відображають взаємовідносини штамів на рівні
роду, виду, підвиду.

Зв’язок роботи з науковими програмами, планами, темами. Дослідження
проводилися відповідно до багаторічної Програми міністерства освіти і
науки України за договором від 16 травня 2001 р. по темі: „Впровадження
молекулярно-генетичних методів детектування комерційних штамів
молочнокислих бактерій — продуцентів біологічно активних речовин”, у
рамках чинної програми Міністерства освіти і науки України „Підтримка і
зберігання об’єкта, що становить національне надбання – колекція
мікроорганізмів Інституту мікробіології і вірусології НАНУ”, а також
згідно п’ятирічного плану наукових праць Інститута мікробіології і
вірусології ім. Д.К. Заболотного НАН України по темі: “Дослідження
систематичного положення та фізіолого-біохімічних особливостей
мікроорганізмів, які мають промислове значення”, номер 0198V007755
(1999-2003 р.).

Мета і задачі дослідження. Мета даної роботи – визначити таксономічне
положення окремих штамів молочнокислих бактерій Української колекції
мікроорганізмів із застосуванням молекулярно-генетичних методів і
розробити методи ідентифікації штамів, що мають промислово важливе
значення. Для досягнення мети були поставлені наступні задачі:

визначити видову приналежність штамів за фенотиповими ознаками;

провести ревізію отриманих даних про видову приналежність штамів за
генотиповими ознаками;

дослідити ділянки генома молочнокислих бактерій, які дозволяють їх
диференціювати на рівні штаму або виду;

розробити праймери і підібрати умови ПЛР для ідентифікації молочнокислих
бактерій.

Об’єктом дослідження були колекційні штами молочнокислих бактерій, які
належать до різних фізіологічних груп. Частина штамів є виробничими і
використовується у складі пробіотиків.

Предметом дослідження було визначення таксономічного положення штамів
молочнокислих бактерій та порівняння традиційних мікробіологічних і
молекулярно-генетичних методів їх ідентифікації.

Матеріали та методи дослідження. Для вивчення таксономічного положення
штамів молочнокислих бактерій використовували класичні методи,
API-тестування, нумеричний аналіз, а також генетичні методи:
рестрикційний аналіз гену 16S рРНК, ПЛР з використанням видоспецифічних
праймерів, RAPD-типування і філогенотипово опосередкований аналіз.

Наукова новизна одержаних результатів. Запропоновано концепцію праймера
змішаного типу, суть якої полягала у використанні в ідентифікації штамів
молочнокислих бактерій RAPD-праймера, що дозволяє з одного боку —
провести штамоспецифічну диференціацію, а з іншого — здійснити їхню
ідентифікацію на рівні виду і підвиду.

Розроблено новий підхід видової ідентифікації молочнокислих бактерій,
заснований на використанні RAPD-праймера, що містить видові відмінності,
разом з праймером-термінатором. Застосування даного підходу по
відношенні до штамів L. plantarum дозволило одержати профіль з єдиним
домінуючим фрагментом масою 860 п. н. За співвідношенням даного
фрагмента з іншим домінуючим за величиною інтенсивності фрагмента був
обчислений коефіцієнт, за яким штами L. plantarum відрізнялися від інших
видів р. Lactobacillus.

Практичне значення одержаних результатів. Запропоновано спосіб
геноідентифікації молочнокислих бактерій для визначення таксономічного
положення споріднених видів, які мають одиночні нуклеотидні відмінності.
З метою захисту штамів на ринку комерційних біопрепаратів розроблена
експрес-система на основі ПЛР. Розроблено комплекс праймерів, що
складається з RAPD-праймера Lp3-st і праймера-термінатора LP2, який
пропонується використовувати при одержанні видової і штамоспецифічної
характеристики штамів L. plantarum. Розроблено програмне забезпечення,
що автоматизує обчислення, пов’язані з проведенням досліджень.

Особистий внесок здобувача. Дисертантом особисто розроблено комп’ютерну
програму, яка автоматизує обчислення, пов’язані з ідентифікацією
молочнокислих бактерій, створені видо- і штамоспецифічні праймери: LP1,
LP2 і Lp3-st. Здобувач запропонував новий підхід у видовій ідентифікації
бактерій на основі даних RAPD-типування, а також вніс зміни в методи з
виділення ДНК, ПЛР і визначення якості секвенованого фрагменту, провів
статистичну обробку даних по виявленню спорідненості штамів, виконав
відбір ендонуклеаз рестрикції, що дозволило диференціювати окремі види
молочнокислих бактерій.

Аналіз результатів, їхнє узагальнення і статистичну обробку,
інтерпретацію даних та формулювання основних положень і висновків
дисертації, підготовку до друку наукових статей здобувачем проведено
особисто під керівництвом наукового керівника дисертаційної роботи
д.б.н., професора Н. К. Коваленко.

Апробація результатів дисертації. Матеріали досліджень повідомлені на
розширеному засіданні комітету з питань гігієнічного регламентування
Міністерства охорони здоров’я України “Идентификация бактерий
молекулярно-генетическими методами” (м. Київ, 2001 р.); на
науково-методичному реферативному семінарі для молодих вчених і фахівців
“Молекулярно-генетические методы идентификации молочнокислых бактерий”
(м. Київ, 2001 р.); на 6-ій Пущинській школі-конференції молодих вчених
“Биология – наука 21-го века” (м. Пущино, 2001 р.); на міжнародній
конференції “Микробиология и биотехнология XXI столетия” (м. Мінськ,
2002 р.), на X з’їзді Товариства мікробіологів України (м. Одеса, 2004
р.) та щорічному конкурсі молодих досліників, що проводиться Інститутом
мікробіології і вірусології НАН України.

Публікації. За темою дисертації опубліковано 8 друкованих праць, 4
статті у виданнях (з них 3 у вахових), рекомендованих ВАК України, 4
– у збірниках матеріалів з’їздів і міжнародних конференцій.

Структура та обсяг роботи. Дисертація викладена на 155 сторінках
машинописного тексту і складається з вступу, огляду літератури, основної
частини (включає матеріали і методи досліджень, результати досліджень і
їхнє обговорення), висновків і списку використаної літератури, що
містить 105 джерел, з них 81 закордонних авторів. Робота ілюстрована 38
таблицями і 54 малюнками.

ОГЛЯД ЛІТЕРАТУРИ

Огляд літератури складається з трьох підрозділів, в яких висвітлено
сучасний стан і перспективи розвитку систематики мікроорганізмів, у тому
числі молочнокислих бактерій; розглянуті питання розвитку їхньої
таксономічної структури. Показано роль цих мікроорганізмів у
життєдіяльності людини. Велика увага приділяється опису фенотипових і
генотипових методів, що використовуються при вивченні таксономії
мікроорганізмів, оптимізації методів виділення ДНК молочнокислих
бактерій, значенню гена 16S рРНК у систематиці бактерій.

МАТЕРІАЛИ І МЕТОДИ ДОСЛІДЖЕНЬ

Об’єктами дослідження були 34 штами роду Lactobacillus Beijerinck 1901 і
2 штами роду Streptococcus Rosenbach 1884. Штами отримані з різних
міжнародних колекцій: Всеросійської колекції промислових
мікроорганізмів (ВКПМ), Американської колекції типових культур (ATCC),
Національної колекції молочних мікроорганізмів (NCDO, Англія) і ін., у
тому числі типові. Частина штамів виділені співробітниками відділу
фізіології промислових мікроорганізмів і зберігаються в Українській
колекції мікроорганізмів (УКМ).

Вирощування культур проводили на середовищі МРС шляхом декількох
пасажів. Вивчали морфолого-культуральні і фізіолого-біохімічні ознаки
досліджених штамів. Ідентифікацію проводили, використовуючи API-системи
з програмним забезпеченням APILAB Plus версії 3.3.3 і
молекулярно-біологічні методи, деякі з яких були вдосконалені.

Вивчення таксономічного положення молочнокислих бактерій, що проявили
гетерогенні властивості, проводили в порівнянні з типовими культурами,
для чого використовували нумеричний аналіз штамів за 73 ознаками. Для
побудови дендрограми застосовували метод зваженого попарного групування
(Simple average — weighted pair-group) як той, що вірно відображає
взаємодії між штамами.

Геноідентифікацію штамів молочнокислих бактерій проводили за допомогою
штамоспецифічних (R-Lact і Lp3_st) і видоспецифічних (LP1, LP2 і Lp3_sp)
праймерів (табл. 1).

Таблиця 1

Характеристика праймерів, використаних в ідентифікації

молочнокислих бактерій

Назва Послідовність 5’->3’ Напрямок Тпл, C0 GC,% Довжина, н

LP1 TGGACCGCATGGTCCGAGC прямий 53,8 55,0 20

LP2 ACCACCTGTATCCGTGTCCC зворотний 53,3 60,0 20

Lp3_sp TGGACCGCATGGTCCGAGC прямий 61.3 68.4 19

Lp3_st TGGTCCGAGC — 19,0 70.0 10

Температуру віджигу (Твід) вибирали в залежності від пари праймерів і
специфічності реакції. Видову приналежність визначали за допомогою пари
праймерів LP1 і LP2 (Твід = 480С), Lp3_sp і LP2 (Твід = 520С). Для
комплексної ідентифікації на рівні штаму і виду одночасно
використовували Lp3-st і LP2 (Твід = 480С). Аналізували геномну ДНК, ген
16S рРНК або клітини досліджуваних штамів.

Аналіз ампліфікованого гену 16S рРНК досліджуваних штамів здійснювали
за допомогою комплексу рестриктаз: Pma CI, Cfr, HaeII і BamHI. Інкубацію
ендонуклеаз рестрикції проводили при 370С протягом 20 хв у Buffer
Y+/TangoTM (1х), після чого проводили електрофорез отриманих фрагментів
в агарозному гелі. Для визначення нуклеотидної послідовності фрагментів
ДНК використовували секвенатор CEQ2000XL (Beckman) і систему для
аналізу ДНК версії 4.2.0. Якість отриманих послідовностей гена 16S рРНК
перевіряли за допомогою програми BLAST за рядом копій для кожного виду,
що знаходяться в базі даних GENBANK. Зони, що містили помилкові
нуклеотиди і пропуски, з подальшого аналізу виключалися.

Статистичну обробку даних проводили за допомогою комп’ютерної програми
NCSS2000 and PASS2000.

РЕЗУЛЬТАТИ ДОСЛІДЖЕНЬ ТА ЇХ ОБГОВОРЕННЯ

Фенотипова характеристика штамів молочнокислих бактерій з використанням
нумеричного аналізу. Дослідження фенотипових ознак штамів показало, що
найбільша гетерогенність проявилася при ферментації джерел вуглеводів.
Слід зазначити, що здатність засвоювати вуглеводи є одним з важливих
критеріїв, що використовується у визначенні видів і підвидів
молочнокислих бактерій.

Порівняльний аналіз видової приналежності штамів згідно вуглеводного
живлення, отриманого раніше при первинному виділенні культур, показав,
що в процесі тривалого зберігання спектр вуглеводів, що збражувались, у
цих штамів змінився. Підтвердженням цьому був прояв атипичних
властивостей у деяких видів: L. delbrueckii, L. agilis, L. confusus
та ін., що робило неможливим чітке визначення штамів на рівні виду і
підвиду. Отримані за API-тестуванням дані для більшості штамів співпали
з результатами прояву їх морфолого-культуральних і
фізіолого-біохімічних властивостей (табл. 2).

Таблиця 2

Порівняльна характеристика результатів АPI-тестування лактобацил

Первинна назва ID,

% Видова назва

за API-тестуванням Видова назва згідно фенотипових ознак

L. delbrueckii subsp. bulgaricus B-1923 99.9 L. plantarum L. plantarum

L. plantarum B-2627 99.9 L. plantarum L. plantarum

L. amylophilus 30/4/(2) 99.9 L. plantarum L. plantarum

L. acidophilus 4356 99.9 L. rhamnosus L. rhamnosus

L. plantarum B-2209Т 99.9 L. plantarum L. plantarum

L. plantarum B-2677Т 99.9 L. plantarum L. plantarum

L.brevis 474 99.9 L. brevis L. brevis

L. confusus 39T 99.7 L. fermentum L. fermentum

L. agilis B-2603 99.6 L. fermentum L. fermentum

L. delbrueckii subsp. bulgaricus Lb51 96.0 L. acidophilus L.
delbrueckii

L. delbrueckii subsp. delbrueckii B-1596Т 95.6 L. delbrueckii subsp.
delbrueckii L. delbrueckii subsp. delbrueckii

L. acidophilus B-1660Т 99.5 L. acidophilus L. acidophilus

L. delbrueckii subsp. bulgaricus B-2700 99.3 Leuconostoc mesenteroides
subsp. mesenteroides —

L. amylophilus B-2234Т — — L. amylophilus

ID – відсоток подібності до видів у базі даних програми APILAB PLUS
3.3.3, „-”-видова приналежність штаму не визначена

Для деяких з них, навпаки, спостерігалася суперечливість даних. Серед
них був штам L. delbrueckii subsp. bulgaricus Lb51, який за
API-тестуванням був визначений як L. acidophilus. В той же час, штам L.
amylophilus B-2234Т не був ідентифікований, тому що отриманий
вуглеводний профіль не виявив подібності, достатньої для видового
визначення даного штаму.

Згідно даних нумеричного аналізу за 73 ознаками встановили ступінь
подібності штамів між собою (рис. 1).

Рис. 1. Групування штамів лактобацил на основі нумеричного аналізу.
Кластери видів L. plantarum (I), L. fermentum (II) і L. delbrueckii
(III) (див. табл. 3).

Штами, ідентифіковані як L. plantarum, сформували загальний кластер I.
До них близький за властивостями був L. acidophilus 4356,
ідентифікований як L. rhamnosus. Два штами L. confusus 39T і L. agilis
B-2603, що були перевизначені як L. fermentum (згідно даних
API-тестування) і які виявили високу спорідненість, утворили кластер II.
Штами L. delbrueckii subsp. bulgaricus Lb51 і L. delbrueckii subsp.
delbrueckii B-1596Т згрупувалися у кластер III. До цієї групи близьким
за властивостями був штам L. acidophilus B-1660.

Отримана дендрограма дозволила зробити висновок про таксономічну
подібність штамів між собою. Оскільки штам L. delbrueckii subsp.
bulgaricus Lb51 виявив більшу спорідненість до L. delbrueckii, на
відміну від даних API-тестування, яке враховувало тільки вуглеводний
спектр, його віднесли до L. delbrueckii.

Таблиця 3

Евклідова відстань між штамами молочнокислих бактерій,

що утворюють загальний кластер

Штам* Подібний штам Евклідова відстань

L. plantarum B-19231 L. plantarum B-2209Т 0.19

L. plantarum B-2627 L. plantarum B-2677Т 0.27

L. delbrueckii subsp. bulgaricus Lb51 L. delbrueckii subsp.

delbrueckii B-1596Т 0.48

L. plantarum 30/4/(2)2 L. plantarum B-2677Т 0.49

L. fermentum B-26033 L. confusus 39T 0.53

L. delbrueckii subsp. bulgaricus B-2700 L. amylophilus B-2234Т 0.57

L. rhamnosus 43564 L. plantarum B-2677Т 0.59

L. fermentum 39T5 L. brevis 474 0.63

L. acidophilus B-1660Т L. delbrueckii subsp. delbrueckii B-1596Т 0.78

*первина назва штаму: 1-L. delbrueckii subsp. bulgaricus B-1923, 2-L.
amylophilus 30/4/(2), 3-L. agilis B-2603, 4-L. acidophilus 4356 і 5-L.
confusus 39T

Таким чином, використання стандартних даних API-тестування з
урахуванням фенотипових ознак дозволило ідентифікувати L. delbrueckii
subsp. bulgaricus B-1923 у L. plantarum, L. agilis B-2603 – у L.
fermentum, L. acidophilus 4356 — у L. rhamnosus, L. amylophilus
30/4/(2) – у L. plantarum. Таксономічне положення деяких інших штамів
було не визначено через прояв гетерогенності їхніх властивостей і тому
було уточнене генотиповими методами: L. amylophilus 30/4/(2), L.
acidophilus 4356, L. agilis B-2603, L. confusus 39T, L. delbrueckii
subsp. bulgaricus Lb51, L. delbrueckii subsp. bulgaricus B-2700, L.
delbrueckii subsp. bulgaricus B-1923 і L. brevis 474.

Генотипова характеристика досліджуваних штамів. Проведений
рестрикційний аналіз дозволив уточнити видову приналежність штамів,
таксономічне положення яких не можна було встановити на основі даних,
отриманих за допомогою мікробіологічних методів. За отриманими профілями
рестрикції гена 16S рРНК вдалося визначити L. delbrueckii subsp.
bulgaricus Lb51 на рівні підвиду, ідентифікувати L. delbrueckii subsp.
bulgaricus B-2700, як представника роду Leuconostoc, штам L.
delbrueckii subsp. bulgaricus B-1923 віднести до виду L. plantarum і
т.д. З таблиці 4 видно, що рестрикційний аналіз не дав чіткого
визначення видової приналежності штаму L. delbrueckii subsp. bulgaricus
B-2700. Також залишилося невизначеним таксономічне положення штаму L.
confusus 39T, який за своїми властивостями не відповідав L. plantarum,
до якого його було віднесено згідно даних рестрикційного аналізу. Тому
для подальшої ідентифікації цих штамів скористалися секвенуванням гена
16S рРНК.

Таблиця 4

Дані про видову приналежність штамів молочнокислих бактерій за
рестрикційним аналізом

Первинна назва Проміжна видова назва* Вид за рестрикційним аналізом

L. delbrueckii subsp. bulgaricus Lb51 L. delbrueckii L. delbrueckii
subsp. bulgaricus

L. delbrueckii subsp. bulgaricus B-2700 Lеuc. mesenteroides subsp.
mesenteroides Lеuc. mesenteroides,

o

o

T AE

E

i

i

o

o

AE

E

H?+^,4-U-D/1/40Z3U5O9 >>C–EOKjMZP\P~P?T?TOT?X`[V^c_oooiiiiiaaaiaaOOiOOaa
iI

&

`c`?`1/4`O`/iiaaaaaO

6a`ata~a?a?aooiiss

b»b,b2booeUUU

^„a$

N

m

\

6

N

m

\

6

N

m

\

6

N

m

\

6

N

m

\

6

N

m

\

6

N

m

\

6

N

m

\

6

N

m

\

6

N

m

\

6

N

m

\

6

N

m

\

6

N

m

\

6

N

m

\

6

]„

”y

N

m

\

6

”yE

±

”yE

±

”yE

±

”yE

±

”yE

±

”yE

±

”yE

±

”yE

±

us B-1923 L. plantarum L. plantarum

*- видова назва штамів на підставі нумеричного аналізу з урахуванням
фенотипових ознак і даних API-тестування.

Штами виявили гомологію з послідовностями в GENBANK у межах 99-100%, на
підставі чого були зроблені висновки про їхню видову приналежність
(табл. 5). Так, штам L. delbrueckii subsp. bulgaricus B-2700 був
віднесений до виду Leuconostoc pseudomesenteroides; L. confusus 39T- до
виду L. pentosus.

Таблиця 5

Видова ідентифікація молочнокислих бактерій за допомогою

видоспецифічної ділянки 16S рДНК

Штам* Довжина ділянки, н Результати BLAST-аналізу

Відмінності, н. Подібність,% Гомологічний вид Код GENBANK

L. delbrueckii subsp. bulgaricus B-2700 600 1 99 Leuc.
pseudomesenteroides AF468002

602 2 99 Leuc. pseudomesenteroides AF515228

L. agilis B-2603 473 1 99 L. fermentum AF243166

584 2 99 L. fermentum AF243166

L. plantarum B-2677 623 2 99 L. plantarum AF320256

564 1 99 L. plantarum,

L .paraplantarum,

L. pentosus LBA16RRN1,

LPA306297,

LBA16RRN2

L. plantarum B-2627 274 0 100 L. plantarum LBA16RRN1

L. amylophilus 30/4/(2) 578 0 100 L. plantarum LBA16RRN1

474 0 100 L. plantarum,

L .paraplantarum,

L. pentosus LBA16RRN1,

LPA306297,

LBA16RRN2

L. confusus 39Т 515 2 99 L. pentosus LBA16RRN2

354 3 99 L. paraplantarum,

L. pentosus,

L. plantarum LPA306297,

LBA16RRN2,

LBA16RRN1

*- напроти назви штаму вказано довжина фрагмента, отриманого за
допомогою прямого праймера pА (верхній рядок) і зворотнього праймера pН
(нижній рядок)

Lp3-st – RAPD-праймер для оцінки генетичного споріднення штамів. Для
диференціації штамів роду Lactobacillus і встановлення з ними
споріднення штаму L. confusus 39Т використовували праймер Lp3-st.
Праймер Lp3-st — RAPD-праймер з видоспецифічною послідовністю гена 16S
рРНК L. plantarum. Мета даного вибору полягала в одержанні додаткової
характеристики штамів L. plantarum на генетичному рівні з урахуванням
видових особливостей штамів у вигляді сполучення фрагментів, по якому
можна визначити подібність штамів як споріднених, так і інших видів роду
Lactobacillus.

Було встановлено, що профіль штаму L. confusus 39Т виявив високу
спорідненість із профілем L. plantarum, різниця між якими склала 6% і
істотну різницю в подібності до L. fermentum B-2603, що склала 33% (рис.
2).

А
Б

Рис. 2. Дендрограма спорідненості штамів (А) по RAPD-профілям (Б),
отриманими за допомогою праймера Lp3-st.

За допомогою фрагментів, які утворилися після використання Lp3-st і
LP2 обчислили коефіцієнт (Кpl) для штамів виду L. plantarum. Було
встановлено, що Кpl коливався в межах 10-4 для штамів L. plantarum, а
для інших видів – 2-1. Штам L. confusus 39Т мав недостатньо високий Кpl,
який дорівнював 1.52. Таким чином, цей штам виявивши високу
спорідненість до штамів L. plantarum, одночасно, мав суттєві
відмінності, які не дозволили віднести його до виду L. plantarum.
Враховуючи дані філогенетично опосередкованого аналізу, а також
суттєву різницю між L. confusus 39Т та штамами L. fermentum його
віднесли до L. pentosus.

Розробка праймерів до L. plantarum і їх ідентифікація. Підсумовуючи
результати проведених досліджень з вивчення мінливості спейсерних
ділянок (SR), а також самого гена 16S рРНК, було встановлено, що жоден з
перерахованих ділянок генома не мав досить нуклеотидних відмінностей,
щоб провести штамоспецифічне типування. Одиночні нуклеотидні
відмінності, що потенційно несуть видоспецифічне навантаження і можуть
бути використані в диференціації штамів L. plantarum і близько
наближених видів, були зосереджені у великому SR і гені 16S рРНК.

Спираючись на дані, одержані в результаті проведеного аналізу
мінливості гена 16S рРНК, було створено два варіанти праймерів: LP1, LP2
і Lp3-sp, LP2. Комбінація праймера Lp3-sp і LP2, на відміну від LP1 і
LP2, визначала споріднені види, які мали між собою незначні відмінності
в послідовності гена 16S рРНК. Ідентифікація штамів L. plantarum
відбувалася за фрагментом з молекулярною масою 875 п. н. У споріднених
видів, наприклад, штаму L. pentosus 39Т, даний фрагмент був відсутній
(рис. 3).

1 2 3
4 5 6 7 М

Рис. 3. ПЛР-профілі штамів лактобацил, які отримані за допомогою
праймерів Lp3-sp і LP2 при Твід=52 С0. 1 — L. plantarum B-2209Т, 2
— L. plantarum B-2677Т, 3 — L. plantarum 30/4/(2), 4 — L. plantarum
B-1923, 5 — L. fermentum B-2603, 6 — L. pentosus 39Т, 7 — L. rhamnosus
4356, М – ДНК-маркер.

Використовуючи праймери LP1 і LP2, підтверджено видову приналежність
штамів, які за іншими тестами були визначені як L. рlantarum: L.
plantarum B-1923, L. plantarum B-2209Т, L. plantarum 30/4/(2), L.
plantarum B-2627, L. plantarum B-2677Т, а також ідентифіковано штами L.
рlantarum серед L. amylophilus і L. fermentum.

Порівняльна характеристика методів. Аналіз даних видової ідентифікації
штамів роду Lactobacillus підтвердив літературні дані про мінливість
фенотипових ознак у цієї групи мікроорганізмів. Частина з них виходила
за рамки опису виду, що не дозволило чітко визначити видову
приналежність штамів. Зокрема, невідповідність опису виду відносилася до
L. delbrueckii subsp. bulgaricus Lb51 і L. brevis 474. Нехарактерна
для молочнокислих бактерій властивість була виявлена у штама L. confusus
39T, а саме здатність відновлювати нітрати в нітрити.

В інших штамів, в основному, спостерігалася гетерогенність у прояві
ферментування вуглеводного спектра, здатності до росту при різних
температурах, різних концентраціях NaCl та інше, що вимагало проведення
додаткових тестів. Дані про видову приналежність штамів, отримані за
допомогою API-тестування, у більшості випадків були коректними, але для
деяких штамів нетипове ферментування вуглеводів не дозволило визначити
вид штаму або привело до невірної ідентифікації, наприклад, L.
delbrueckii subsp. bulgaricus Lb51.

Проведення нумеричного аналізу дозволило встановити відносну
спорідненість між різними штамами. Штами одного виду, як правило,
формували загальний кластер. Отримані дані, в основному, корелювали з
результатами фенотипової характеристики штаму, однак вимагали
підтвердження на генетичному рівні. Видову приналежність штамів з
гетерогенними фенотиповими ознаками вдалося встановити за допомогою
рестрикційного аналізу гена 16S рРНК. Однак у штамів споріднених видів,
що мали незначні відмінності в нуклеотидних послідовностях гена 16S
рРНК, видова приналежність потребувала уточнення. З цією метою
використовували більш чутливий метод порівняльного аналізу нуклеотидних
послідовностей гена 16S рРНК, який враховував окремі нуклеотидні
відмінності. При використанні саме цього метода стала можливою
диференціація штамів споріднених видів, таких як L. plantarum і L.
pentosus.

Використання RAPD-типування, а також комплексу RAPD-праймера і
“консервативного” праймера-термінатора, дозволило розширити
характеристики штамів на генетичному рівні, встановити їх споріднення, а
за рядом виявлених закономірностей і їх приналежність до виду L.
plantarum.

З усіх перерахованих вище методів найбільш точним і універсальним був
той, що враховував нуклеотидну послідовність гена 16S рРНК. Методи, що
базуються на аналізі SR, були менш диференцюючими і мали обмеження в
кількості видових нуклеотидних послідовностей, представлених у Genbank.
Використання комплексу RAPD-праймера і “консервативного” праймера також
дали більш точну оцінку видової приналежності штамів. Проте, даний
підхід не був таким універсальним, як секвенування гена 16S рРНК. Він
обмежувався видом, на який була орієнтована структура RAPD-праймера.
Незважаючи на видове обмеження, модифікований RAPD-підхід може виявитися
корисним тоді, коли на рівні гена 16S рРНК спостерігаються незначні
відмінності в описі виду. У цьому випадку встановлене генетичне
споріднення дозволяє визначити відношення мікроорганізму до того або
іншого виду. При дослідженні штамів молочнокислих бактерій RAPD-підхід
дозволив підтвердити дані аналізу гена 16S рРНК.

Провівши комплекс досліджень на фенотиповому і генетичному рівні, було
отримано підтвердження видової приналежності більшості штамів
молочнокислих бактерій, а для окремих штамів відповідно до отриманих
характеристик проведена їх рекласифікація (табл. 6)

Таблиця 6

Список нових видових назв штамів молочнокислих бактерій

Вихідна назва штаму Нова видова назва штаму

L. acidophilus 4356 L. rhamnosus 4356

L. agilis B-2603 L. fermentum B-2603

L. amylophilus 30/4/(2) L. plantarum 30/4/(2)

L. confusus 39T L. pentosus 39Т

L. delbrueckii subsp. bulgaricus B-1923 L. plantarum B-1923

L. delbrueckii subsp. bulgaricus B-2700 Leuconostoc
pseudomesenteroides B-2700

ВИСНОВКИ

Проведено ідентифікацію штамів за фенотиповими ознаками. Показано
нестабільність ключової ознаки – ферментації вуглеводів при визначенні
штамів роду Lactobacillus на видовому і внутрішньовидовому рівні.

Уточнено таксономічне положення штамів молочнокислих бактерій з
використанням молекулярно-генетичних методів: рестрикційного,
філогенотипово опосередкованого аналізу та інших.

Знайдено ендонуклеази рестрикції, що дозволили встановити видову
приналежність штамів завдяки виявленій гетерогенності 16S рРНК деяких
видів молочнокислих бактерій.

Використано новий підхід із застосуванням RAPD-типування, що дозволило
розширити характеристики штамів філогенетично споріднених видів і
встановити їхню видову приналежність.

Встановлено, що серед ділянок генома молочнокислих бактерій придатними
для диференціації штамів на видовому рівні є ген 16S рРНК, на рівні
групи споріднених видів -велика і мала спейсерна ділянка 16S-23S рРНК.

На основі ПЛР-методу створено експрес-систему для ідентифікації
промислово важливих штамів лактобацил, що відносяться до виду L.
plantarum, яка включає RAPD-праймер Lp3-st і праймер-термінатор LP2.

Розроблено комп’ютерну програму GenProbe мовою програмування С++
Builder, яка дозволяє автоматизувати обчислення, пов’язані з
приготуванням розчинів, проведенням електрофорезу і ПЛР.

СПИСОК ПРАЦЬ, ОПУБЛІКОВАНИХ ЗА ТЕМОЮ ДИСЕРТАЦІЇ

Лащевский В.В., Коваленко Н.К. Поиск эндонуклеаз рестрикции,
обнаруживающих гетерогенность 16S рРНК некоторых видов молочнокислых
бактерий // Микробиол. журн. – 2002. – т. 64, №2. – С. 21-28.

Лащевский В.В., Коваленко Н.К. Конструирование праймеров к ДНК
молочнокислых бактерий // Микробиол. журн. – 2003. – т. 65, №.3 – С.
46-53.

Коваленко Н.К., Лащевский В.В. Применение метода полимеразной цепной
реакции (ПЦР) для идентификации молочнокислых бактерий // Молочна
промисловість. – 2003. – №1(4). – С. 24-25.

Лащевский В.В., Коваленко Н. К. Определение видовой принадлежности
штаммов рода Lactobacillus с использованием RAPD-типирования //
Микробиол. журн. – 2004. – т. 66, №4. – С. 3-13.

Лащевский В.В. Использование полимеразной цепной реакции (ПЦР) в
идентификации молочнокислых бактерий//Бюлетень Інституту
Сільско-господарської мікробіології – 2000., №7.- С. 19.

Лащевский В.В., Коваленко Н.К. Некоторые аспекты конструирования
праймеров к ДНК молочнокислых бактерий // 6-я Пущинская школа
–конференция молодых ученых “Наука XXI века”, 20-24 мая 2001 года,
Пущино. – Сб. тезисов, т. 1. – С. 91.

Лащевский В.В., Коваленко Н.К. Подходы к конструированию праймеров для
молочнокислых бактерий // Микробиология и биотехнология XXI столетия,
22-24 мая 2002 года, Минск. – Материалы международной конференции, С.
139.

Лащевский В.В., Коваленко Н.К. Рекласифікация штамів роду Lactobacillus
з використанням RAPD-типування // X з’їзд Товариства мікробіологів
України, 15-17 вересня 2004 р., Одеса. – Тези доповідей, С. 222.

АНОТАЦІЯ

Лащевський В.В. Нові підходи до ідентифікації молочнокислих бактерій.
Рукопис. Дисертація на здобуття наукового ступеня кандидата біологічних
наук за спеціальністю 03.00.07 – мікробіологія.- Інститут мікробіології
і вірусології НАН України, Київ, 2005.

Дисертація присвячена таксономічним дослідженням молочнокислих
бактерій, що зберігаються в Українській колекції мікроорганізмів.
Показано, що гетерогенність властивостей лактобактерій створює значні
труднощі при їх ідентифікації. Враховуючи дані, що були отримані за
допомогою фенотипових методів, і, використовуючи розширену
характеристику штамів, яку склали завдяки молекулярно-генетичним
методам, була встановлена видова приналежність штамів, які мали неясне
таксономічне положення. Виявлена гетерогенність ключової ознаки —
ферментації вуглеводів у встановленні таксономічного положення
представників роду Lactobacillus на видовому і внутрішньовидовому рівні.
Представлено результати нумеричного аналізу властивостей молочнокислих
бактерій із невизначеним таксономічним положенням. Знайдено ендонуклеази
рестрикції, що виявляють гетерогенність гена 16S рРНК деяких видів
молочнокислих бактерій. У визначенні видової приналежності молочнокислих
бактерій використано новий підхід із застосуванням комплексу
RAPD-праймера і праймера-термінатора, що розширив характеристики штамів
на генетичному рівні. Аналізом нуклеотидних послідовностей молочнокислих
бактерій, узятих з бази даних GENBANK, показано, що придатним для
визначення на видовому рівні є ген 16S рРНК, на рівні груп споріднених
видів — спейсерна ділянка 16S-23S рРНК. На основі ПЛР створена
експрес-система для ідентифікації промислово важливих штамів лактобацил,
що відносяться до виду L. plantarum. Розроблено комп’ютерну програму
мовою програмування С++Builder для ідентифікації молочнокислих бактерій,
що дозволяє автоматизувати обчислення, пов’язані з приготуванням
розчинів, проведенням електрофорезу і ПЛР.

Ключові слова: Lactobacillus, фенотипові ознаки, RAPD-типування, 16S
рРНК, BLAST, ПЛР (полімеразна ланцюгова реакція), рестрикційний аналіз.

АННОТАЦИЯ

Лащевский В.В. Новые подходы к идентификации молочнокислых бактерий.

Рукопись. Диссертация на соискание ученой степени кандидата
биологических наук по специальности 03.00.07 – микробиология.- Институт
микробиологии и вирусологии НАН Украины, Киев, 2005.

Диссертация посвящена таксономическим исследованиям молочнокислых
бактерий, хранящихся в Украинской коллекции микроорганизмов. Показано,
что проявление гетерогенности при сбраживании углеводов, выявление
нетипичных свойств (восстановление нитратов в нитриты), нечеткое
проявление таких признаков, как рост в присутствии NaCl, температурные
точки роста и др. у отдельных штаммов создает проблемы при их
идентификации. С помощью фенотипических методов и расширенной
характеристики штаммов, составленной посредством
молекулярно-генетических методов, была установлена видовая
принадлежность штаммов, имеющих неясное таксономическое положение.
Гетерогенность ключевого признака – сбраживание углеводов, проявилась
при определении таксономического положения представителей рода
Lactobacillus на видовом (штаммы L. plantarum, L. fermentum и др.) и
внутривидовом уровне (штаммы подвидов L. delbrueckii). Представлены
результаты нумерического анализа молочнокислых бактерий с неясным
таксономическим положением по 73 фенотипическим признакам. Видовая
принадлежность штаммов была установлена по их положению в дендрограмме
сходства относительно типовых культур и с учетом результатов
API-тестирования. Найдены эндонуклеазы рестрикции, обнаруживающие
гетерогенность гена 16S рРНК некоторых видов молочнокислых бактерий:
штаммы L. confusus и L. fermentum были разделены StyI, PmaCI и PstI, а
штаммы других видов – с помощью эндонуклеаз рестрикций, среди которых
HaeII, EcoRI и BamHI. В определении видовой принадлежности молочнокислых
бактерий, относящихся к L. plantarum, использован новый подход с
применением комплекса RAPD-праймера Lp3-st и праймера-терминатора LP2,
расширивший характеристики штаммов на генетическом уровне за счет
отличий в характеристике видоспецифического фрагмента у представителей
других видов. Анализом нуклеотидных последовательностей молочнокислых
бактерий: 16S рРНК, большого и малого спейсерного участка 16S-23S рРНК,
взятых из GENBANK, показано, что пригодным для определения штаммов L.
plantarum на видовом уровне является ген 16S рРНК, который имеет
нуклеотидное отличие, позволившее дифференцировать посредством ПЦР такие
близкородственные виды как L. plantarum, L. paraplantarum и L. pentosus.
В отличие от 16S рДНК, анализ спейсерного участка 16S-23S рРНК выявил
ограничения при видовом определении штаммов, принадлежащих
близкородственным видам. На основе ПЦР создана экспресс-система,
применяющая видоспецифические праймеры LP3-sp и LP2 для идентификации
промышленно важных штаммов лактобацилл, относящихся к виду L. plantarum.
Разработана компьютерная программа на языке программирования С++
Builder, которая использовалась при идентификации молочнокислых
бактерий, автоматизировавшая вычисления, связанные с приготовлением
растворов, проведением электрофореза и ПЦР.

Ключевые слова: Lactobacillus, фенотипические признаки,
RAPD-типирование, 16S рРНК, BLAST, ПЦР (полимеразная цепная реакция),
рестрикционный анализ.

ABSTRACT

Lashchevsky V.V. New approaches to identification of lactic acid
bacteria.

Manuscript.The candidate degree thesis by speciality 03.00.07 –
microbiology. Zabolotny Institute of Microbiology and Virology of the
National Academy of Sciences of Ukraine, Kyiv, 2005.

The dissertation is devoted to taxonomic researches of lactic acid
bacteria (LAB) stored in the Ukrainian collection of microorganisms
(UCM). It was shown that heterogeneity of their phenotypical properties
creates significant difficulties for their identification. The proper
taxonomic position of strains that haven’t clear species definitions
were defined by molecular methods and using phenotypic data. It was
established the atypical fermentation reactions for some Lactobacillus
strains. For LAB definitions, it was presented the numeric analysis
data. Also, the restriction endonucleases were selected to reveal
heterogeneity of a 16S rDNA for some LAB species. The new approach was
introduced into identification of LAB at species level. It was based on
application of RAPD-primer and the primer-“terminator” and allowed to
supply genetic characteristics of strains. The analysis of 16S rDNA
sequences of LAB from GENBANK was confirmed data to reference to
identification of closely related species using 16S rDNA sequences and
shown the limits of 16S-23S spacer region. The PCR express-system was
developed for identification of industrially important L. plantarum
strains. The special computer program was written by C++ Builder. It was
used in computing appurtenant to preparation of solution, PCR and et.al.

Keywords: Lactobacillus, phenes, RAPD-typing, 16S rRNA, BLAST, PCR
(polymerase chain reaction), restriction analysis.

PAGE 2

I

II

III

L.brevis 474

L. fermentum B-2603

L. confusus 39T

L. plantarum B-2209Т

L. plantarum B-1923

L. plantarum 64n

L. plantarum 30/4/(2)

L. plantarum 213

L. plantarum B-2677Т

L. plantarum B-2627

L .rhamnosus 4356

L. paracasei subsp. paracasei 67t

L. delbrueckii subsp. bulgaricus Lb51

L. delbrueckii subsp. delbrueckii B-1596Т

L. acidophilus B-1660Т

L. delbrueckii subsp. bulgaricus B-2700

L. amylophilus B-2234Т

500

2000

100

Похожие записи