УКРАЇНСЬКА АКАДЕМІЯ АГРАРНИХ НАУК

Інститут експериментальної і клінічної

ветеринарної медицини

ГЕРІЛОВИЧ Антон Павлович

УДК 619:616.98:578.825.1-07

Хвороба марека: індикація і вивчення біологічних властивостей збудника
та розробка засобів діагностики

16.00.03 — ветеринарна мікробіологія та вірусологія

АВТОРЕФЕРАТ

дисертації на здобуття наукового ступеня

кандидата ветеринарних наук

Харків – 2005

Дисертацією є рукопис.

Робота виконана в Інституті експериментальної і клінічної ветеринарної
медицини УААН.

Науковий керівник доктор ветеринарних наук,
професор

Білокінь Віктор Степанович, Інститут експериментальної і клінічної
ветеринарної медицини УААН, головний науковий співробітник лабораторії
біотехнології.

Офіційні опоненти: доктор ветеринарних наук, професор

Апатенко Володимир Максимович, Харківська державна зооветеринарна
академія, завідувач кафедри мікробіології, вірусології та імунології;

кандидат ветеринарних наук

Пархоменко Людмила Іванівна, Луганський національний аграрний
університет МАП України, доцент кафедри мікробіології і вірусології.

Провідна установа Сумський національний аграрний університет МАП
України, кафедра вірусології, патанатомії та ветсанекспертизи.

Захист відбудеться “25” жовтня 2005 р. о “13” годині на засіданні
спеціалізованої вченої ради Д 64.359.01 в Інституті експериментальної і
клінічної ветеринарної медицини УААН.

З дисертацією можна ознайомитись у бібліотеці Інституту
експериментальної і клінічної ветеринарної медицини УААН за адресою:
61023, м. Харків, вул. Пушкінська, 83.

Автореферат розісланий “20” вересня 2005 р.

Вчений секретар

спеціалізованої вченої ради,

доктор ветеринарних наук,

професор _______________________ А.Ф. Бабкін ЗАГАЛЬНА ХАРАКТЕРИСТИКА
РОБОТИ

Актуальність теми. Хвороба Марека (ХМ) має значне поширення серед
свійської та дикої птиці майже в усіх країнах світу. Особливості
патотипічної та сероваріантної структури збудника значно ускладнюють
діагностику та заходи профілактики ХМ (Witter R., 1997; 2000). У
більшості країн з розвиненим птахівництвом щороку хвороба Марека
наносить значних економічних збитків – біля 1 млрд. $ США (Calnek B.,
1998). Основним способом попередження цього захворювання в усьому світі
є профілактика з використанням живих вакцин. Штами першого серотипу
являють особливу небезпеку з точки зору утворення пухлин в організмі
людини при контакті з живим вірусом (Laurent S., 2001; 2004).
M. Parcells (2000, 2003) неодноразово вказував на взаємозв’язок між
ВХМ-віремією та атеросклерозом людини.

Циркуляція вірусу ХМ серед птахопоголів’я в Україні вивчена поверхнево,
невідомо, які серо- і патотипи домінують. Розповсюдженню збудника сприяє
необґрунтоване застосування імпортних полівалентних вакцин та вакцин, що
містять вірус першого серотипу, яких на українському ринку зареєстровано
понад 10 різновидів. Застосування полівалентних вакцин призводить до
значної імунодепресії; при їх використанні можуть утворюватись
рекомбінації вакцинних та патогенних штамів з непередбачуваними
біологічними властивостями (vv i vv+-патотипів).

В Україні не зареєстровано жодного діагностичного набору для індикації
антигену вірусу хвороби Марека (ВХМ), або його генетичного матеріалу. Ще
й досі патологоанатомічний розтин лишається єдиним діагностичним
прийомом. Існує також еритроцитарний діагностикум для РНГА, проте цей
метод дослідження має недостатню діагностичну інформативність і дозволяє
виявити антитіла до збудника лише на пізніх стадіях інфекційного
процесу.

У зв’язку з цим індикація та вивчення біологічних властивостей польових
ізолятів, розробка і впровадження засобів діагностики хвороби Марека є
актуальними напрямками наукових досліджень.

Зв’язок роботи з науковими програмами, планами, темами. Робота
виконувалась згідно з тематичним планом наукових досліджень ІЕКВМ,
затвердженим Українською академією аграрних наук, у рамках завдання 07
„Розробити та впровадити комплексні системи діагностики, терапії і
профілактики інфекційних хвороб птиці” (2000-2005 рр.), номер
держреєстрації 0101U001612.

Мета і задачі дослідження. Мета досліджень – з’ясування епізоотичної
ситуації щодо хвороби Марека в Україні, індикація та вивчення
біологічних властивостей збудника і розробка засобів діагностики цього
захворювання.

Для досягнення цієї мети були поставлені такі задачі:

вивчити епізоотичну ситуацію з хвороби Марека в Україні та провести
вірусологічні дослідження з визначення циркуляції її збудника в
птахогосподарствах;

провести ідентифікацію епізоотичних ізолятів вірусу хвороби Марека та
визначити їх інфекційну активність;

встановити серотипову і патотипову належність польових ізолятів вірусу
за патогенністю для курячих ембріонів і курчат добового віку та
молекулярно-генетичними тестами;

розробити засоби для діагностики хвороби Марека (РДП і ПЛР).

Об’єкт дослідження: хвороба Марека.

Предмет дослідження: вірус хвороби Марека, біологічні властивості,
засоби діагностики, реакція дифузної преципітації (РДП), полімеразна
ланцюгова реакція (ПЛР).

Методи дослідження. Робота виконана з використанням епізоотологічних,
клінічних, патологоанатомічних, вірусологічних, серологічних,
молекулярно-генетичних та статистичних методів досліджень.

Наукова новизна одержаних результатів. Вперше проведені широкі
вірусологічні дослідження щодо розповсюдження вірусу хвороби Марека у
птахогосподарствах України, встановлена циркуляція серед курей трьох
серотипів цього збудника. Експериментально у біопробі на курячих
ембріонах і курчатах визначена патогенність штамів вірусу ХМ.
Встановлено циркуляцію слабкопатогенних (m-патотип), середньої
(v-патотип) та високої (vv-патотип) патогенності штамів І серотипу, що
теоретично обґрунтовано і експериментально підтверджено в біопробі та за
ПЛР виявленням у них послідовності гену онкопротеїну Meq.

Розроблені нові тест-системи для діагностики ХМ у РДП та індикації
патогенних штамів ВХМ першого серотипу в ПЛР.

Новизна розробок захищена трьома деклараційними патентами України і
трьома патентами на корисні моделі.

Практичне значення одержаних результатів. Результати досліджень
використані при розробці нормативної документації щодо виготовлення,
контролю і застосування «Тест-системи для діагностики хвороби Марека в
реакції дифузної преципітації» та «Meq-oncoprotein DNA-тест», які
схвалені методичною комісією ІЕКВМ УААН та передані на експертизу до
ДНКІБШМ. Розроблені способи виготовлення антигену ВХМ, схема
гіперімунізації тварин та спосіб детекції онкогенних штамів ВХМ-1
методом nested-ПЛР; запропоновані “Методичні рекомендації щодо
діагностики хвороби Марека”, які затверджені НТР Державного департаменту
ветеринарної медицини МАП України (протокол № 4 від 27 грудня 2004).

Основні положення, що виносяться на захист:

Результати вірусологічного скринінгу та вивчення біологічних
властивостей польових штамів ВХМ.

Виготовлення концентрованих антигенів ВХМ та гіперімунних сироваток для
створення тест-системи для діагностики ХМ в РДП.

Метод індикації геному онкогенних штамів ВХМ-І в nested-ПЛР з праймерами
на ділянку гену Meq.

Особистий внесок здобувача полягає в самостійному виконанні методичних,
аналітичних і експериментальних робіт. Вибір способів очищення антигенів
ВХМ та схем гіперімунізації донорів здійснений за участю кандидата
ветеринарних наук Кіприча В.В.

Апробація результатів дисертації. Основні положення дисертації
доповідалися, обговорені і схвалені на звітних сесіях вченої ради та
засіданнях методичної комісії ІЕКВМ УААН у 2003-2005 роках; Міжнародній
науково-практичній конференції „Актуальні проблеми ветеринарної медицини
в умовах сучасного ведення тваринництва” (26 травня-2 червня 2003 р., м.
Феодосія); Міжнародній конференції молодих вчених (листопад 2003 р., м.
Харків); IV Konferencja “Biologia molekularna w diagnostice chorob
zakaznych i biotechnoloch” (6 грудня 2003 р., Варшава, Польща);
Міжнародній науково-практичній конференції „Ветеринарна медицина-2004”
(24-29 травня 2004 р., м. Феодосія); Міжнародній науково-практичній
конференції “Проблемы эпизоотологии на современном этапе” (19-21
листопада 2004 р., Санкт-Петербург, Росія); Симпозіумі “Veterinarstvo i
stokarstvo u proizwodji zdrawstvevo bezbedne hrane (21 — 25 липня 2004,
Херцег Нові, Сербія і Чорногорія); Міжнародній науково-практичній
конференції „Ветеринарна медицина-2005” (30 травня – 4 червня 2005 р.,
м. Ялта).

Публікації. За матеріалами дисертації опубліковано 11 наукових праць, з
них 8 у фахових виданнях України і 3 за кордоном, а також методичні
рекомендації.

Структура та обсяг дисертації. Дисертація викладена на 131 сторінці
комп’ютерного друку, ілюстрована 15 таблицями і 22 рисунками. Робота
складається з вступу, огляду літератури, матеріалів та методів
досліджень, результатів власних досліджень, аналізу та узагальнення
власних досліджень, висновків і пропозицій виробництву, списку джерел
літератури, який містить 219 найменувань, у тому числі 184 іноземних.

МАТЕРІАЛИ І МЕТОДИ ДОСЛІДЖЕНЬ

Робота виконана в лабораторії біотехнології Інституту експериментальної
і клінічної ветеринарної медицини УААН впродовж 2002-2005 років.

Епізоотичний стан з хвороби Марека в світі вивчали за даними
Міжнародного Епізоотичного Бюро (МЕБ), а в Україні — Державного
департаменту ветеринарної медицини МАП України і Центральної державної
лабораторії ветеринарної медицини.

Індикацію та культивування вірусу ХМ здійснювали в культурах
перещеплюваних (CEF) та первиннотрипсинізованих фібробластів ембріонів
курей (ФЕК), качок (ФЕКач), індичок (ФЕІ) та перепілок (ФЕП), а також
епітеліоцитів нирок курчат та курячих ембріонів, для виготовлення яких
використано близько 200 курячих, 120 перепелиних, 30 качачих, 10 індичих
ембріонів та 25 голів курчат добового віку. Первиннотрипсинізовані
культури фібробластів отримували за загальноприйнятим методом (Сюрин
В.Н., 1991), а клітин нирки курчати — за Miles A. (2001).

Патогенність польових ізолятів для курячих ембріонів вивчали за методом
інфікування на ХАО та в жовтковий мішок (Сюрин В.Н., 1991; Sharma J.,
1985). З цією метою використано близько 500 курячих ембріонів від
племінного стада курей породи білий леггорн, крос Isa White
благополучних з інфекційних хвороб господарств.

Біопроба на курчатах проведена шляхом інтраабдомінальної інокуляції
вірусовміщуючих суспензій у дозі 500-700 ФУО/голову. Наявність та
інфекційну активність вірусу в досліджуваному матеріалі (печінка, очини
пір’я, нерви сідничного сплетіння, селезінка та головний мозок)
визначали за вірусологічними методами в культурі клітин, а патотип
досліджуваних штамів ВХМ — за методом Witter R.L. (1997) та RFLP за
Kozdrun W. (2002).

Антигени для РДП та імунізації донорів одержували методом концентрування
за допомогою фільтрувальних мембран в апараті типу АР-102, преципітації
білкової антигенної фракції додаванням 50% розчину ПЕГ-6000 або діалізу
проти 50% розчину чи сухого ПЕГ-6000. Для підвищення специфічності їх
було виснажено від тканинних антигенів за допомогою протифібробластних
сироваток.

Для гіперімунізації використали курей породи брама та кроликів
чорно-вогняної породи, масою не менше за 2,5 кг. Курям антиген вводили
внутрішньом’язово, підшкірно та внутрішньовенно за двома схемами (з і
без використання ПАФ при першому введенні). Схема імунізації кроликів
передбачала внутрішньовенне введення антигену. При першому введенні до
антигену додавали 5 % димексиду.

Виділення сумарної ДНК з інтактної та інфікованої культури клітин або
суспензії клінічного матеріалу (1:10) проводили за допомогою комерційних
наборів ДНК-Sorb-A та ДНК-Sorb-В (Амплисенс, Москва, Росія) та фенольним
методом (Аминев А.Г., 1997). Випробувано чотири системи праймерів: на
серотипоспецифічні ділянки гену gB (Полехин С.В., 1998); на
консервативну ділянку гену gD І серотипу ВХМ (Laurent S., 2001); для
диференціації онкогенних і неонкогенних штамів ВХМ І серотипу за
розміром амплікону гену Meq (Lee S.-I., 2000).

Теоретичний розрахунок праймерів здійснювали за аналізом нуклеотидних
послідовностей, опублікованих в EMBL GenBank. При аналізі консервативних
ділянок використано програму BioEdit v.5.2.9. Дизайн праймерів
проводився за допомогою програми AmplyX v.1.1.2 для Win98. Аналіз
показників якості послідовностей та оптимізацію ампліфікаційних
термоциклів здійснювали з використанням пакету програм OLYGOSoft.
Праймери люб’язно синтезовані за запропонованими нами послідовностями
Dr. D. Rasсhert (Laboratoire de Virologie, Centre de recherches de
Tours, Франція).

Статистичний аналіз даних проводили за допомогою редактора електронних
таблиць Microsoft Excel XP (2002) та пакету програм Statistica v 6.1
(Rus).

РЕЗУЛЬТАТИ ДОСЛІДЖЕНЬ

Епізоотологічні аспекти хвороби Марека в Україні. За даними МЕБ (О.І.Е.,
2004), ХМ широко розповсюджена на всіх континентах земної кулі, окрім
Антарктиди. В останні 7 років найбільша кількість випадків хвороби
Марека у гострій формі щорічно реєструвалася в США, Аргентині,
Австралії, Мексиці, Канаді, Чілі, Франції, Германії, Ірландії, Новій
Зеландії, Норвегії, Китаї, В’єтнамі, Японії та ін. З країн
пострадянського простору ХМ діагностується щорічно в Росії, Білорусії,
Естонії, Латвії, Литві.

Україна, за даними офіційних джерел, в тому числі МЕБ, вважається
благополучною щодо ХМ (О.І.Е., 2004). У той же час більшість
птахогосподарств здійснюють вакцинопрофілактику. Проаналізовані нами
дані Державного департаменту ветеринарної медицини МАП України за
останні десять років щодо інтенсивності епізоотичного процесу при ХМ
свідчать про поступове зменшення випадків захворювання. Так, якщо у 1994
році в Україні було зареєстровано 20 неблагополучних пунктів, в 1998
році їх кількість скоротилась до одного. 1999 рік супроводжувався
благополуччям країни щодо ХМ, проте, вже в наступному, 2000 році,
зареєстровано 2 неблагополучних пункти (в Харківській та Кіровоградській
областях). З початку 2001 року по цей час територія України вважається
благополучною з хвороби Марека. Обласними лабораторіями ветеринарної
медицини не було отримано жодного зразку патологічного матеріалу для
діагностики цього захворювання. З 6989 досліджених серологічними
методами (РНГА, ІФА) проб крові, отриманих від курей Херсонської
області, лише в 322 виявлені антитіла до ВХМ у високих титрах. Але, як
відомо, серологічні методи не є вирішальними у діагностичному відношенні
(рис. 1).

Рис. 1 Динаміка випадків хвороби Марека в Україні (1994-2004 рр.).

В обстежених нами 15 птахогосподарствах Харківської, Херсонської,
Луганської, Дніпропетровської, Одеської областей та АР Крим встановлено
циркуляцію вірусу хвороби Марека.

Хвороба Марека мала виражену сезонність. У приватних господарствах
перший пік хвороби припадав на кінець весни – початок літа, а другий
охоплював осінь, супроводжуючись максимальною долею летальності (до
45 %). У деяких крупних господарствах колективної форми власності
сезонність співпадала з періодами загострення епізоотичного процесу в
більшості країн світу, тобто лютий-березень і кінець осені.

У дрібних приватних господарствах (50-1000 курей) птиця звичайно не
щепиться проти ХМ. Загибель серед цієї птиці сягає понад 45 % при
гострій формі ХМ. Серед вакцинованого птахопоголів’я доля летальності
мало відрізнялась від цього показника за кордоном і становила 1,5-3 %
[Луганська птахофабрика (зараз Авіс), 1994-1998 рр.] серед несучок та до
4,5 % у бройлерів (господарства “АгроУкрПтаха”, “Авіс” на Луганщині; ВАТ
“Партизан”, приватні господарства м. Мерефа та с. Борки Харківської
області). Також у ВАТ “Партизан” у часи інтенсивного вирощування
бройлерів (2000-2001 рр.) реєструвалось підвищення відходу від ХМ до
3,6 % у весняні місяці серед невакцинованих молодок.

Спалахи ХМ як у гострій, так і в класичній формах перебігу проявлялись
серед птахопоголів’я 38-200-добового віку. Всі діагностовані нами
випадки ХМ мали спорадичний або ензоотичний характер.

Із патологоанатомічних змін в органах всієї дослідженої господарчої
птиці найбільш характерним для обох форм перебігу хвороби Марека було
однобічне потовщення сідничного нерва (близько 20% випадків), що
властиве для класичної форми цього захворювання (рис. 2).

Рис. 2 Питома вага патоморфологічних змін при хворобі Марека

Знаходили також ураження селезінки як гіпертрофічного (біля 16%), так і
атрофічного характеру (12,9%). Вираженими були гіперплазія нирок,
збільшення сім’яників та яєчників, менш численними були випадки редукції
яєчників з дрібними новоутвореннями (близько 9%). У деяких випадках
виявляли гіпертрофію серцевого м’яза (3%) та новоутворення в підшкірній
клітковині та пір’яних фолікулах (3-4%). В 15,2% випадків знаходили
лімфоми в печінці. Ураження пір’яних фолікулів, м’язові новоутворення,
некрози кишечника та інші патології, спричинені ВХМ, відмічали лише в
поодиноких випадках (ВАТ “Червоний прапор” Луганської області та
“ХерсонПтахоСервіс” Херсонської області).

Індикація та вивчення біологічних властивостей польових ізолятів ВХМ. З
метою індикації штамів ВХМ в культурі клітин було проведено розтин 370
трупів загиблої та тушок забитої з діагностичною метою птиці, від яких
був відібраний клінічний матеріал.

За результатами вірусологічних досліджень з використанням культур клітин
виділено 33 вірусні ізоляти.

Найчастіше вірус ізолювали з епітелію пір’яних фолікулів (ізоляти P-1,
Р-2, Р-3; HPS; ЧП-1/1, ЧП-1/2; УАП-1, УАП-2; Авіс-1, Авіс-2, Авіс-3;
Odessa; Borky-2 та ГХ), селезінки (BelGer-1; P-3; ЧП-1/2, ЧП-2/1;
ЛВВХП-1; SL-1, SL-2; УАП-1, УАП-3, УАП-5; Авіс-4; Odessa; Borky 31/12;
Bolshevik), крові (HPS; Borky-1/1, 1/2, 1/3; Bolshevik; Alexandrovsk
PF), печінки (BelGer-2; ЧП-2/1; УАП-3; Авіс-2; Borky 31/12), менше — з
нирок (ЧП-2/1) та головного мозку (BelGer-2).

Деструктивні зміни в культурі ФЕК проявлялись на 5-9 добу після
зараження, після трьох-п’яти пасажів досліджуваного матеріалу.
Розмноження більшості ізолятів ВХМ у клітинних культурах
супроводжувалось розвитком бляшок овальної чи округлої форми, які
стосовно чинника ХМ називають фокусами. Останні являли собою формування
багатоядерних синцитіїв уражених вірусом ХМ фібробластів, що
переломлюють світло при мікроскопії.

Характерною особливістю репродукції ВХМ у клітинній культурі була його
адаптація і поступове накопичення, що призводило до утворення фокусів.
Спочатку, на 4-6 добу після інфікування, формувались первинні, діаметром
0,15-0,4 мм, а на 6-9 добу з’являлись вторинні фокуси, які мали вигляд
рефрактильних уражених клітин, а їх розмір знаходився в межах 0,07-0,2
мм. Проте, деякі ізоляти, зокрема ЧП-1/1, ЧП-1/2 та ЧП-2/1, у процесі
розмноження призводили до появи “вікон” у моношарі зараженої культури
клітин, внаслідок їх відшаровування або, можливо, лізису (табл. 1).

У культурі ФЕП ізоляти BelGer-1, 2; Borky 1/1-1/3; HPS; ЧП-1/1, -1/2,
2/1; ЛВВХП-1; Odessa; Borky-2; Borky 31/12; SL-1, SL-2; Merepha-2004;
ГХ; Bolshevik та Alexandrovsk PF розмножувались без прояву деструктивних
змін у клітинах. У той же час, в культурах ФЕК та ФЕКач через 3-5 діб
після інфікування ці ізоляти призводили до утворення дрібних фокусів,
0,25-0,35 мм у діаметрі.

Таблиця 1

Культивування ізолятів ВХМ в різних культурах клітин, морфологія фокусів
та інфекційна активність

Ізоляти Досліджуваний матеріал Культури клітин

ФЕК

ФЕП

ФЕКач

Морфологія і час появи фокусів Інфек-ційна актив-ність, ФУО/

см3

BelGer-1, 2; Borky 1/1-1/3; HPS; ЧП-1/1, — 1/2, 2/1; ЛВВХП-1; Odessa;
Borky-2; Borky 31/12; Merepha 2004, ГХ; Bolshevik; SL-1, SL-2,
Alexandrovsk PF кров, епітелій пір’яних фолі-кулів, селе-зінка, нирки,
фабрицієва бурса, печінка, головний мозок + — + округлі та овальні
бляшки діаметром 0,15-0,4 мм на

3-5 добу після інфікування 1200-25000

Р-1, Р-2 та Авіс-1-4 епітелій пір’я-них фолікулів, селезінка, нир-ки,
фабрицієва бурса, печінка + +/- — округлі та овальні бляшки діаметром
0,09-0,2 мм на 3 добу після інфікування 3600-100000

УАП 1-5 та Р-3-5 те саме + + — бляшки діаметром до 1 мм на 3 добу після
інфікування та вікна в моношарі на 5-6 добу до 16000

Ізоляти Р-1, Р-2 та Авіс-1, Авіс-2, Авіс-3, Авіс-4 другого-третього
пасажу при розмноженні в культурі ФЕК на 3 добу формували фокуси, які
представляли собою угрупування великих вакуолізованих клітин та
клітинних тяжів. У центрі фокусу локалізувався осередок подвійного
заломлення світла. Діаметр їх не перевищував 0,09-0,2 мм. У культурі ФЕП
ці ізоляти розмножувались з проявом через 48-72 годин округло-овальних
фокусів. Їх діаметр коливався з 0,07 (Авіс) до 0,3 мм (Р-1, Р-2). В
культурі ФЕКач ці віруси репродукували без проявлення будь-яких змін.

Ізоляти УАП-1, УАП-2, УАП-3, УАП-4, УАП-5 та Р-3, Р-4, Р-5 спричиняли на
4-5 пасажі появу великих бляшок в культурі ФЕК, діаметр яких досягав до
1 мм. Середина цих фокусів за 1-4 доби ставала рефрактильною, пізніше
клітини піддавались апоптозу, спричиняючи утворення у моношарі «вікон».
Клітинний моношар за 5-6 діб після інфікування вражався на 60-90 %. Ці
віруси також утворювали слабко виражені зміни в культурі ФЕП, які були
відсутні при культивуванні в культурі ФЕКач. Фокуси виявлялись через
одну-дві доби культивування інфікованих клітин, їх діаметр досягав
0,7-1 мм.

Виділені польові ізоляти ВХМ відрізнялись не тільки за характером прояву
деструктивних змін у моношарі заражених клітин, але і за інфекційною
активністю, яка коливалася від 1200 ФУО/см3 (ізолят BelGer-2) – 25000
ФУО/см3 (ізолят Borky 31/12) до 100000 ФУО/см3 (ізоляти Авіс).

Визначення патотипу досліджуваних ізолятів за результатами оцінки їх
патогенності для курячих ембріонів та курчат. Більшість досліджуваних
ізолятів уражала 45-100 % інфікованих курячих ембріонів, у яких
спостерігали утворення бляшок на ХАО розміром 0,25-2,5 мм, підшкірні
крововиливи, набряк печінки та стінки кишечника.

Ізоляти Авіс, УАП та Р виявилися апатогенними для КЕ, останні
фізіологічно розвивалися аж до виведення з них курчат.

Як найбільш патогенні для КЕ були визначені ізоляти Borky 31/12,
Merepha 2004, Bolshevik та Alexandrovsk PF ВХМ. При зараженні
однодобових курчат у дозі 500 ФУО/голову вони спричиняли захворювання
8,5 – 50 % птиці і загибель до 20 %. У курчат, інфікованих ізолятами
Borky 31/12 та Bolshevik, розвивалась класична (нервова) форма хвороби
Марека. На розтині загиблих відмічали загальне виснаження, дистрофічні
процеси у м’язах та селезінці. Клінічні ознаки та загибель
реєструвались, починаючи з 42 доби після зараження.

Паралельно була визначена локалізація досліджуваних ізолятів в різних
органах та їх інфекційна активність (табл. 2). Всі досліджувані штами
локалізувались в печінці та пір’яних фолікулах інфікованої птиці.

На 50-70 добу більшість вірусів виділяли з головного мозку та нирок.
Найбільш висока інфекційна активність ізоляту Merepha 2004 відмічена в
пір’яних фолікулах та селезінці. Найбільш

Таблиця 2

Інфекційна активність ізолятів ВХМ,

виділених із різних органів експериментально заражених курчат

Органи Ізоляти та їх титри інфекційності, ФУО/см3

Borky

Bolshevik

Merepha

2004

Alexandrovsk PF

30 діб

Головний мозок — — 168,00±13,56 —

Нирки — 276,00±27,13 — 290,00±9,48

Пір’яні фолікули 910,00±24,49 3920,00±501,39 2820,00±373,36 2880,00±

115,76

Печінка 738,00±122,81 — 1280,00±139,28 102,00±5,83

50 діб

Головний мозок 20,60±0,40 — 292,00±17,43 —

Нирки — 868,00±96,04 480,00±91,59 1044,00±

46,75

Пір’яні фолікули 3280,00±58,30 5720,00±688,77 20800,00±

1655,29 9600,00±

927,36

Печінка 710,00±101,34 780,00±58,30 700,00±89,44 1000,00±

54,77

70 діб

Головний мозок 2280,00±66,33 — 650,00±83,66 3300,00±

130,38

Нирки 358,00±41,40 1720,00±259,61 — —

Пір’яні фолікули 10340,00±

2509,90 9400,00±927,36 9880,00±155,61 4600,00±

246,98

Печінка 347,00±92,24 — 670,00±62,45 332,00±12,40

Селезінка 420,00±12,24 3380,00±185,47 10400,00±1029,56 1500,00±

109,54

Залозис-тий шлунок 346,00±16,21 — — 334,00±20,39

інтенсивне накопичення відбувалось на 50-70 добу, про що свідчать
найвищі титри виділених вірусів — 10400,00±1029,56 –
20800±1655,29 ФУО/см3. На 70 добу збільшилася інфекційна активність
ізоляту Borky 31/12 у головному мозку та пір’яних фолікулах і, навпаки,
низькою залишалася в селезінці (420,00±12,24 ФУО/см3).

На цей час одним із методичних прийомів визначення патотипу польових
ізолятів ВХМ є постановка біопроби на інтактних та вакцинованих
курчатах. Критерієм високої патогенності та епізоотичної небезпеки
ізоляту є його здатність викликати захворювання і загибель серед
вакцинованої птиці. Встановлено, що ізолят Merepha 2004 ВХМ спричиняв
захворювання на ХМ та загибель серед невакцинованих (30 %) і
вакцинованих (20 %) курчат, на підставі чого він був класифікований як
високо вірулентний (very virulent, vv). Інші досліджені ізоляти ВХМ не
призводили до захворювання у заражених ними вакцинованих курчат.
Оскільки ізолят Alexandrovsk PF ВХМ викликав проявлення ранніх клінічних
ознак хвороби 20 % та загибель 10 % невакцинованих курчат, а на розтині
знаходили виражені патологічні зміни, він був

класифікований як v (virulent, вірулентний). Для ізолятів Borky 31/12 та
Bolshevik були властивими захворювання 10 % заражених курчат,
відсутність випадків загибелі, стерті патологічні зміни на розтині, що
характерно для m-патотипу.

Результати визначення патотипу були підтверджені методом
рестрикційно-ензимного картування.

При ідентифікації за ПЛР з праймерами на ділянку гену глікопротеїду В
встановлена належність ізолятів BelGer, HPS, Borky-1, ЧП-1, ЛВВХП-1,
Odessa, SL, Merepha 2004, Borky-2, Borky 31/12, ГХ, Bolshevik,
Alexandrovsk PF та ЧП-2 до першого серотипу ВХМ. При цьому одночасно
доведена наявність у них онкогенних властивостей за різницею довжини
ампліконів гену Meq (рис.3). Ізоляти УАП та Р-3-5 — віднесено до штамів
третього, а Авіс-1-4 і Р-1-2 – до другого серотипу ВХМ.

1240 п.н.

1062 п.н.

М CVI/ 1 2 3 4

Risp.

D

$ F A u oe

hE5C

???$?

O

O

O

O

&

O

O

O

3

O

$

O

3

O

3

O

3

O

O

O

O

O

O

$

O

O

O

O

$

O

O

O

O

O

O

O

????l????? ДНК (DNA Ladder 1200 bp).

Розробка тест-системи для діагностики хвороби Марека в реакції дифузної
преципітації. При накопиченні вихідної сировини для виготовлення
антигенів, перш за все, були підібрані чутливі до досліджуваних вірусів
клітинні системи. Встановлено, що найбільш придатною для культивування
штамів SBG і FC-126 вірусу герпесу курей та індичок є культура
фібробластів курячих чи перепелиних ембріонів, яка забезпечувала
отримання вірусовміщуючої сировини з інфекційною активністю 1,1-1,3х105
ФУО/см3. Вірус хвороби Марека першого серотипу, штам Borky 31/12,
проявляв оптимальну репродуктивну активність лише в культурі
фібробластів КЕ з максимальним титром інфекційної активності 7,9х104
ФУО/см3.

Оптимальний термін інкубації заражених клітин, за який уражались 70-80%
клітин моношару, складав 5-7 діб. Це забезпечувало максимальне
накопичення клітиннозв’язаного вірусу для виготовлення антигену.

У дослідженнях з очистки та концентрування вірусовміщуючої сировини за
допомогою осадження 50% ПЕГ-6000, або діалізу її проти сухого ПЕГ були
отримані концентрати антигенів з активністю в розведеннях до 1:128. При
концентруванні вірусовміщуючої клітинно-культуральної біомаси після
дворазового заморожування-відтавання та видалення детриту
центрифугуванням, ультрафільтрації на колонках типу АР-102 і осадження
за допомогою 50 % розчину ПЕГ-6000 отримані концентрати антигену з
активністю 1:256-1:512. Однак, неспецифічність цих антигенів залишалась
досить вираженою в РДП з сироватками крові інтактних курей.

Видалення залишків тканинних білків із вірусовміщуючої сировини було
досягнуто виснаженням за допомогою специфічної сироватки крові проти
інтактних фібробластів у співвідношенні 5:1 і експозиції впродовж
12 годин при кімнатній температурі (+200С) (табл. 3). Оброблені таким
чином антигени навіть у нативному стані не реагували з
протифібробластною сироваткою в РДП. За результатами випробування схем
гіперімунізації, складу антигенів, кількості, активності та
специфічності отриманих сироваток ми обрали в якості донорів кролів, які
несприйнятливі в природних умовах до збудника ХМ.

Таблиця 3

Ефективність режимів виснаження

антигенів ВХМ від антигенних детермінант ФЕК

Показники Залишкова активність антигенних детермінант ФЕК в розведеннях
через:

Температура, 0С 8 год. 12 год. 18 год. 24 год.

37 0 0 0 0

20 1:32 1:1 0 0

4 1:128 1:128 1:64 1:32

Співвідношення антиген-сироватка 8 год. 12 год. 18 год. 24 год.

3:1 0 0 0 0

5:1 0 0 0 0

10:1 1:64 1:32 1:8 1:2

Антигени готували на основі 5 % димексиду, який, як відомо, здатний
підтримувати концентрацію антигенного субстрату в крові та пролонгувати
його дію.

Для одержання специфічних сироваток до ВХМ використані виснажені
антигени з вірусів кожного серотипу. При відпрацюванні технології
одержання специфічних гіперімунних сироваток нами випробувані різні
схеми гіперімунізації, для чого використали курей та кролів.

При імунізації півнів і курей одержані гіперімунні сироватки до ВХМ з
титром антитіл в РДП на рівні 3-5 та 4-6 log2, відповідно.

При гіперімунізації кролів через 4 доби після внутрішньовенного введення
виснажених антигенів ВХМ-І, ВХМ-ІІ та ВХМ-ІІІ, що включали димексид,
титри специфічних антитіл складали 3-4 log2, 2 log2 та 4 log2,
відповідно (рис. 4). Наступне внутрішньовенне введення антигенів без
димексиду, через 5 діб після першого, підвищувало титри антитіл у
донорів до 5, 4 та 6 log2, відповідно. Через чотири доби після
останнього внутрішньовенного введення титри преципітинів в сироватках
донорів досягали рівня 5, 5 та 7 log2, а ще через 10 діб — 6, 6 і 8
log2, відповідно, після чого на чотирнадцяту добу кролів знекровлювали.

Рис. 4 Динаміка накопичення преципітувальних антитіл до ВХМ у кролів

При формуванні діагностичного набору використали антиген із штаму SBG
(ВХМ-ІІ), який виявився найбільш активним (розведення 1:512) та
придатним для індикації антитіл до кожного з трьох серотипів ВХМ. З
урахуванням можливого зниження його активності під час зберігання до
складу тест-системи входить антиген з активністю 4 преципітувальних
одиниці (розведення 1:64). Поріг чутливості тест-системи для детекції
антитіл до ВХМ – 1 log2. Щодо детекції антигену запропоновані сироватки
з активністю в розведенні 1:64. Вони здатні виявляти ВХМ у суспензіях із
органів, пір’яних фолікулів і зараженої культури клітин.

При вивченні специфічності компонентів тест-системи для діагностики ХМ в
РДП встановлено, що виготовлена гіперімунна сироватка реагує лише з
антигеном ВХМ і не проявляє реакції з антигенами штамів БЧ і Ла-Сота
вірусу ньюкаслської хвороби, ВНИИБП-У вірусу ІЛТ та вірусів інфекційної
бурсальної хвороби і віспи.

Преципітувальна активність антигену ВХМ проявлялась лише в реакції з
позитивною до ВХМ сироваткою при відсутності такої в РДП з сироватками
інтактних курей, а також гіперімунними сироватками до реовірусу, ІЛТ,
віспи птиці та ньюкаслської хвороби.

Розробка тест-системи для індикації ДНК патогенних штамів ВХМ в
полімеразній ланцюговій реакції. Для визначення ділянки оптимальної
ампліфікації ДНК онкогенних вірусних штамів першого серотипу нами
проведено порівняльний скринінг нуклеотидних послідовностей гену
8 епізоотичних та 4 вакцинних штамів ВХМ І, опублікованих у базі даних
EMBL, а саме: GA, 648А, 660 А, JM, RB1B, Md5, W, U та HPRS15/6, BC-1,
Conn-2, CVI 988. Аналіз даних щодо варіабельності гену, здійснений за
допомогою програми BioEdit, показав, що для вакцинних і онкогенних
штамів ВХМ єдиною загальною ділянкою є послідовність 1-60 п.н. Що
стосується окремо групи патогенних штамів, то вони мають 6-9 загальних
консервативних ділянок, придатних для розробки праймерів, довжина яких
перевищує 20 п.н.

Оскільки основним завданням досліджень була детекція виключно онкогенних
штамів, нас не влаштовував максимальний ступень варіабельності ділянки
~700-900 п.н., що відповідає інсерції у 172-178 п.н. (CVI 988, та інші
вакцинні штами). За нормальну варіабельну ділянку визнано відрізок гену,
локалізований на 5′-кінці, з 61 по 700 п.н. Цей відрізок містить сталі
області на всій довжині, саме його було проаналізовано за допомогою
програми AmplyX на наявність якісних праймерних ділянок. Встановлено, що
в ньому локалізується більше 20 пар фрагментів, придатних для
використання в якості праймерів, які фланкують різні області довжиною
від 100 до 500 п.н. При оцінці цих послідовностей за загальноприйнятими
параметрами PCR-quality, які включали GC (не < 45%), мали розмір 18-25 п.н., здатність до віджигу при 55-60 0С та несхильність до димерізації, були обрані дві пари праймерів для nested-ПЛР. Використання саме цієї модифікації пов’язане з малим числом віріонів у досліджуваному матеріалі з повноцінним геномом. Розраховані послідовності отримали назви MDV-1, 2, 3 та 4 (табл. 4). Таблиця 4 Послідовності розрахованих олігонуклеотидів Праймер Послідовність нуклеотидів MDV-1 5' TCGATCTTTCTCTCGGGTCGACTT 3' - 24 п.н. локалізація – 62 п.н MDV-2 5' ATAGGGCAAACTGGCTCATGACGA 3' - 24 п.н. локалізація - 383 п.н. Продукт - 321 п.н. MDV-3 5' CCCAACAGCCCCTCCAAACA 3' - 20 п.н. локалізація – 118 п.н. MDV-4 5' TCATGACGAGCCAACTGTACAC 3' - 22 п.н. локалізація – 380 п.н. Продукт - 286 п.н. Було підібрано оптимальний склад реакційної суміші, який при об’ємі в 30 мкл складався з 5 мкл десятикратного ПЛР-буферу (з 1,5 мМ MgCl2), 2,5 ОД Taq-ДНК-полімерази – 0,5 мкл, по 1 мкл праймерів (MDV 1-2 для першого етапу ПЛР та MDV 3-4 для другого при їх робочій концентрації 1 пМ/мкл); 2,5 мкл розчину dNTP (по 2,5 мМ кожного/мкл), 5 мкл розчину досліджуваної проби сумарної ДНК і до 30 мкл деіонізованої води. При цьому обрано оптимальний цикл ампліфікації (табл. 5). При оцінці чутливості з’ясовано, що запропонована тест-система здатна виявляти ДНК навіть 0,1 ФУО ВХМ, що містились в 100 мкл проби з титром ВХМ 1 ФУО/см3. Приблизно така мінімальна концентрація вірусу спостерігалась у гомогенатах патологічного матеріалу з органів, де активність ВХМ під час інфекції була найменшою. Отже, індикаційна здатність тест-системи дозволяла детектувати специфічну ДНК в органах з найменшою локалізацією ВХМ. У інфікованої птиці ДНК ВХМ виявляли в фолікулах пір’я навіть в суспензії 1:1000. Після першої ампліфікації встановлено наявність специфічних смуг у трьох пробах клінічного матеріалу від хворих курей та в треку позитивного контрольного зразка ДНК ВХМ-І. Після другої ампліфікації специфічні смуги виявлені в усіх пробах від хворих курей. Проби ДНК з клінічного матеріалу від здорових курей після обох ампліфікацій не давали смуг ампліконів. Таблиця 5 Ампліфікаційні цикли для ПЛР на Meq-ген ВХМ-І Цикл Температура,°С Час, хв Кількість циклів 1 94 40" 59 1' 72 1' 30 2 72 10' 1 3 (nested) 94 40" 59 1' 72 1' 25 4 72 10' 1 Проби сумарної ДНК гетерогенних контролів (сумарна ДНК з суспензій ХАО від курячих ембріонів, інфікованих штамами БЧ і Ла-Сота вірусу ньюкаслської хвороби, ВНИИБП-У вірусу ІЛТ та вірусами інфекційної бурсальної хвороби і віспи) не утворювали смуг ні після першої, ні після другої ампліфікації. На підставі отриманих результатів чутливості та специфічності праймерів у ПЛР при детекції ДНК вірусу ХМ було створено тест-систему для діагностики цього захворювання. ВИСНОВКИ За результатами клініко-епізоотологічних та вірусологічних досліджень вивчено поширення, біологічні властивості та патотип епізоотичних ізолятів збудника хвороби Марека, що циркулюють серед курей у птахогосподарствах України; розроблено тест-системи для виявлення антигену ВХМ й антитіл до нього в реакції дифузної преципітації та індикації ДНК онкогенних штамів вірусу в полімеразній ланцюговій реакції. Епізоотична ситуація з хвороби Марека в Україні характеризується нестабільністю, що проявляється зменшенням кількості неблагополучних осередків з 20 (1994) до 2 (2000) та поступовим її збільшенням до одинадцяти (2004 р.). В епізоотичних вогнищах спалахи хвороби Марека перебігають у гострій та класичній формах серед курей 38-200-добового віку, супроводжуються загибеллю до 45 % ураженого птахопоголів'я і мають виражену сезонність (лютий та жовтень-листопад). При дослідженні 370 проб клінічного та патологічного матеріалу від курей неблагополучних з хвороби Марека господарств виділено 33 епізоотичні ізоляти, 19 з яких за результатами ПЛР ідентифіковано як першого, 6 - другого і 8 - третього серотипів ВХМ. Виділені епізоотичні штами розрізняються за патогенністю для курячих ембріонів і курчат та інфекційною активністю в культурі ФЕК, яка коливається від 1200 до 100000 ФУО/см3, у залежності від локалізації в організмі ураженої птиці. Штами першого серотипу вірусу хвороби Марека спричиняють захворювання та загибель 8,5-50 % курчат і відхід до 100 % (Alexandrovsk PF і Merepha-2004) курячих ембріонів. За рівнем патогенності для інтактних та вакцинованих курчат штами Borky 31/12 та Bolshevik вірусу хвороби Марека І серотипу (захворювання 10 % курчат, класична форма перебігу, стерті патологічні зміни на розтині) класифіковані як m-патотип (слабко патогенні), штам Alexandrovsk PF (захворювання та загибель по 20 %, гостра форма перебігу, лімфопроліферативні зміни в стінці залозистого шлунку) – як v- (вірулентний), a штам Merepha 2004 (за здатністю викликати в біопробі захворювання і загибель 20 % імунізованих моновакциною зі штаму FC-126 курей) - як vv- патотипи (високо вірулентний). Розроблено технологію виготовлення специфічного антигену з активністю в розведеннях 1:256-1:512 для діагностики хвороби Марека в РДП і напрацювання специфічної до збудника сироватки крові шляхом гіперімунізації донорів, яка включає культивування вірусу в культурі ФЕК, дворазове заморожування-відтавання суспензії інфікованих клітин, видалення клітинного детриту центрифугуванням при 2000 об./хв впродовж 20 хвилин, фільтрування через мембрани установки АР-102, концентрування 11,5 % ПЕГ-6000 та виснаження тканинних антигенів за допомогою протифібробластної сироватки крові. Розроблена схема імунізації донорів, що полягає у дво-триразовому внутрішньовенному введенні антигену з додаванням 5 % димексиду при першій ін'єкції, дозволяє отримувати специфічні до ВХМ сироватки з активністю 6-8 log2 у РДП, що на 1-3 log2 більше, ніж при застосуванні класичної схеми з використанням антигену на основі ПАФ, яка передбачає введення антигену з високою концентрацією білка. На основі отриманих компонентів створена тест-система РДП для індикації антигену ВХМ в клінічному і культуральному матеріалі, а також специфічних до ВХМ антитіл у сироватках крові птиці та жовтках інкубаційного яйця. Активність та специфічність компонентів тест-системи доведена в міжлабораторних комісійних випробуваннях з гетерогенними антигенами вірусів ІЛТ, НХ, ІБХ, віспи і специфічними сироватками до інших збудників вірусних хвороб птиці. Послідовність нуклеотидів 1020/1200 п.н. ділянки гену Meq 8 епізоотичних і 4 вакцинних штамів є висококонсервативною для патогенного вірусу хвороби Марека першого серотипу. Обчислені чотири олігонуклеотидні послідовності, які попарно фланкують ділянки довжиною 321 і 286 п.н., запропоновано використовувати як праймери для nested-ПЛР. Тест-система для детекції ДНК онкогенних штамів вірусу хвороби Марека, що розроблена на основі праймерів MDV-1, MDV-2, MDV-3 та MDV-4, дозволяє виявляти ділянку геному в пробі досліджуваного матеріалу з активністю вірусу до 1 ФУО/см3, що відповідає за чутливістю світовим аналогам. ПРОПОЗИЦІЇ ДЛЯ ПРАКТИКИ Нормативна документація на технологію виготовлення “Тест-системи для діагностики хвороби Марека в РДП” (схвалена на засіданні методичної комісії ІЕКВМ УААН, протокол № 8 від 17 травня 2004 р.). Нормативна документація на технологію виготовлення тест-системи для індикації онкогенних штамів ВХМ “MDV Meq oncoprotein DNA-тест” (схвалена на засіданні методичної комісії ІЕКВМ УААН, протокол № 7 від 26 квітня 2004 р.). “Методичні рекомендації щодо діагностики хвороби Марека” (затверджені НТР Державного департаменту ветеринарної медицини МАП України, протокол № 4 від 27 грудня 2004 р.). Спосіб одержання цільновіріонного концентрованого преципітувального антигену вірусу хвороби Марека. Спосіб одержання гіперімунних сироваток до вірусу хвороби Марека (ВХМ). Спосіб диференціації штамів та ізолятів вірусу хвороби Марека. Спосіб індикації ДНК патогенних штамів вірусу хвороби Марека першого серотипу. СПИСОК ПРАЦЬ, ОПУБЛІКОВАНИХ ЗА ТЕМОЮ ДИСЕРТАЦІЇ Stegniy B.T., Bilokin’ V.S., Gerilovich A.P. Comparative characteristics of biological properties of some field isolates and vaccine strains of Marek’s disease virus in Ukraine// Math of IV Konfer. “Biologia molekularna w diagnostyce chorob zakaznych. – Warszawa, 2003. – P.: 191-193. (Пошукачем проведені всі експериментальні дослідження, обробка даних та їх узагальнення). Герілович А.П. Вивчення епізоотичного стану з хвороби Марека та її профілактики в Україні// Ветеринарна медицина, міжвід. тем. наук. збірник. - Харків, 2004. - № 83. – С. 28-31. Герілович А.П. Вірус хвороби Марека (огляд літератури)// Ветеринарна медицина, міжвід. тем. наук. збірник. - Харків, 2004. - № 83. – С. 32-38. Ідентифікація та визначення онкогенності вірусу хвороби Марека методом ПЛР/ Герілович А.П., Стегній Б.Т., Вербицький П.І., Білокінь В.С., Дригін В.В., Щербакова Л.О.// Ветеринарна медицина, міжвід. тем. наук. збірник. – Харків, 2004. – № 84. – С. 205-208. (Дисертантом відібраний клінічний матеріал та проведені його дослідження вірусологічними та молекулярно-генетичними методами, обробка даних та підбір літературних джерел для обґрунтування проблеми). Індикація збудника хвороби Марека птиці за допомогою полімеразної ланцюгової реакції (ПЛР)/ Стегній Б.Т., Вербицький П.І., Білокінь В.С., Герілович А.П.// Ветеринарна медицина України. – 2004. – № 10. – С. 5-8. (Пошукач провів дослідження клінічного матеріалу від інфікованої птиці, проаналізував та узагальнив результати досліджень). Білокінь В.С., Герілович А.П. Патогенність польових ізолятів вірусу хвороби Марека для курячих ембріонів// Вісник Сумського ДАУ. – Суми, 2004. – № 7(12). – 12-15. (Дисертантом проведена індикація польових штамів вірусу хвороби Марека і вивчена їх патогенність для ембріонів курей, здійснена статистична обробка та узагальнення одержаних результатів). Стегний Б.Т., Белоконь В.С., Герилович А.П. Разработка средств диагностики при болезни Марека: получение антигенов, гипериммунных сывороток и IgY// Мат. междунар. научно-произв. конф. “Актуальные проблемы эпизоотологии на современном этапе”. – СПб, 2004. – С.126-127. (Пошукач особисто здійснив підбір методичних прийомів з напрацювання антигенів, гіперімунних сироваток та імуноглобулінів Y, провів експериментальні дослідження і статистичну обробку одержаних даних). Stegniy B.T., Gerilovich A.P. Bilokin’ V.S. The development of AGP components for Marek’s disease diagnostics// Math. Symp.“Veterinarstvo i stokarstvo u proizwodji zdrawstvevo bezbedne hrane”. – Herceg Novi, 2004. – P. 99-103. (Дисертант провів експериментальні дослідження, літературний пошук та часткове узагальнення одержаних результатів). Розробка компонентів РДП для діагностики хвороби Марека/ Герілович А.П., Стегній Б.Т., Білокінь В.С., Кіприч В.В. // Ветеринарна медицина, міжвід. тем. наук. збірник. – Харків, 2005. – № 85. – 283-287. (Здобувач підібрав методичні прийоми з розробки компонентів реакції, одержання антигенів та сироваток, схеми імунізації). Герілович А.П. Вивчення патогенності польових штамів вірусу хвороби Марека для курчат// Ветеринарна медицина, міжвід. тем. наук. збірник. – Харків, 2005. –№ 85. – С. 276-282. Стегній Б.Т., Білокінь В.С., Герілович А.П. Методичні рекомендації щодо діагностики хвороби Марека. – Харків, 2004. – 18 с. (Пошукачем розроблені та представлені засоби лабораторної діагностики хвороби Марека). Деклараційний пат. 20031210910 Україна, 7 C12N7/00 Ізолят BelGer-1 родина Herpesviridae, підродина ?-Herpesvirinae, вид Gallid herpesvirus type 2, як продуцент преципітувального антигену вірусу хвороби Марека (ВХМ)/ Стегній Б.Т., Білокінь В.С., Герілович А.П., Герман В.В. (Україна); ІЕКВМ УААН . № 71207 А; Заявл. 02.12.2003; Опубл. 15.11.2004. – Бюл. №11. – 2с. Деклараційний пат. 20031210923 Україна, 7 C12N7/00 Спосіб диференціації штамів та ізолятів вірусу хвороби Марека/ Стегній Б.Т., Білокінь В.С., Герілович А.П., Герман В.В. (Україна); ІЕКВМ УААН № 69088 А ; Заявл. 02.12.2003; Опубл. 16.08.2004. – Бюл. №8. – 2с. Деклараційний пат. 20031210911 Україна, 7 C12N7/00 Спосіб адаптації та культивування штаму вірусу герпесу курей SBG на перещеплюваній культурі нирки зеленої мавпи (Vero)/ Стегній Б.Т., Білокінь В.С., Герман В.В., Герілович А.П., Заремба О.В. (Україна); ІЕКВМ УААН № 69085 А ; Заявл. 02.12.2003; Опубл. 16.08.2004. – Бюл. №8 – 2с. Деклараційний пат. на кор. модель 20041008710 Україна, 7 C12N7/00 Спосіб одержання концентрованого цільновірионного преципітувального антигену вірусу хвороби Марека/ Стегній Б.Т., Білокінь В.С., Кіприч В.В., Герілович А.П. (Україна); ІЕКВМ УААН № 7198; Заявл. 25.10.2004; Опубл. 06.07.2005. – Бюл. №6. – 2с. Деклараційний пат. на кор. модель 20040907197 Україна, 7 А61К39/00, C12N7/00 Спосіб одержання гіперімунних сироваток до вірусу хвороби Марека/ Герілович А.П., Стегній Б.Т., Білокінь В.С., Стегній М.Ю. Кіприч В.В. (Україна); ІЕКВМ УААН № 5812 ; Заявл. 15.03.2004; Опубл. 15. 03. 2005. – Бюл. №.3. – 3с. Деклараційний пат. на кор. модель 20041210064 Україна, 7 C12Q1/00 Спосіб індикації ДНК патогенних штамів вірусу хвороби Марека першого серотипу/ Стегній Б.Т., Білокінь В.С., Герілович А.П. (Україна); ІЕКВМ УААН № 7889; Заявл. 07.12.2004; Опубл. 15.07.2005. – Бюл. №7. – 4с. Герілович Антон Павлович. Хвороба Марека: індикація і вивчення біологічних властивостей та розробка засобів діагностики. – Рукопис. Дисертація на здобуття наукового ступеня кандидата ветеринарних наук за спеціальністю 16.00.03 – ветеринарна мікробіологія та вірусологія. Інститут експериментальної і клінічної ветеринарної медицини УААН, Харків, 2005. Дисертація присвячена вивченню циркуляції вірусу хвороби Марека в птахогосподарствах України, біологічних властивостей епізоотичних штамів та розробці засобів діагностики цього захворювання. В роботі наведені результати вірусологічних досліджень з індикації збудника в птахогосподарствах України. При дослідженні 370 проб клінічного та патологічного матеріалу від курей неблагополучних з хвороби Марека господарств виділено 33 епізоотичні ізоляти, 19 з яких за результатами ПЛР ідентифіковано як першого, 6 - другого і 8 - третього серотипів ВХМ За патогенністю для курячих ембріонів і курчат виділені ізоляти І серотипу вірусу віднесені до vv-, v- та m-патотипів. Розроблені способи виготовлення специфічних антигенів вірусу хвороби Марека з активністю до 1:512 та гіперімунних сироваток для діагностики цього захворювання в реакції дифузної преципітації. За результатами вивчення послідовності нуклеотидів гену Meq 8 патогенних та 4 вакцинних штамів І серотипу було встановлено, що ця ділянка геному вірусу є висококонсервативною для патогенних ВХМ-І. Теоретично розраховані праймери MDV-1, MDV-2, MDV-3 та MDV-4, що фланкують 321/286 п.н. ділянку, які запропоновано використовувати для детекції ДНК онкогенних штамів ВХМ І серотипу. Створена на їх основі тест-система, дозволяє виявляти у досліджуваному матеріалі вірусний геном при інфекційній активності збудника на рівні 1 ФУО/см3. Ключові слова: хвороба Марека, вірус хвороби Марека, біологічні властивості, серотип, патотип, реакція дифузної преципітації (РДП), антиген, сироватка, полімеразна ланцюгова реакція (ПЛР), геном, праймери. Герилович Антон Павлович. Болезнь Марека: индикация и изучение биологических свойств возбудителя и разработка средств диагностики. – Рукопись. Диссертация на соискание научной степени кандидата ветеринарных наук по специальности 16.00.03 – ветеринарная микробиология и вирусология. Институт экспериментальной и клинической ветеринарной медицины УААН, Харьков, 2005. Диссертация посвящена изучению циркуляции вируса болезни Марека в птицехозяйствах Украины, биологических свойств эпизоотических штаммов и разработке средств диагностики этого заболевания. В работе приведены результаты вирусологических исследований по индикации возбудителя в птицехозяйствах Украины. При исследовании 370 проб клинического и патологического материала от кур неблагополучных по болезни Марека хозяйств выделено 33 эпизоотических изолята, 19 из которых по результатам ПЦР идентифицировано как первого, 6 - второго и 8 - третьего серотипов ВБМ. По патогенности для куриных эмбрионов и цыплят выделенные изоляты І серотипа вируса отнесены к vv-, v- и m-патотипам. Разработаны способы изготовления специфических антигенов вируса болезни Марека с активностью до 1:512 и гипериммунных сывороток для диагностики этого заболевания в реакции диффузной преципитации. При изучении последовательности нуклеотидов гена Meq 8 патогенных и 4 вакцинных штаммов І серотипа было установлено, что этот участок генома вируса является высококонсервативным для патогенных ВБМ-І. Теоретически рассчитаны праймеры MDV-1, MDV-2, MDV-3 та MDV-4, фланкирующие 321/286 п.н. участок, которые предложено использовать для детекции ДНК онкогенных штаммов ВБМ І серотипа. Созданная на их основе тест-система позволяет выявлять в исследуемом материале вирусный геном при инфекционной активности возбудителя 1 ФОЕ/см3. Ключевые слова: болезнь Марека, вирус болезни Марека, биологические свойства, серотип, патотип, реакция диффузной преципитации (РДП), антиген, сыворотка, полимеразная цепная реакция (ПЦР), геном, праймери. Gerilovich Anton Pavlovich. Marek's disease: indication and studying of causative agent biological properties and development of diagnostics means. - Manuscript. Thesis for scientific degree of the candidate of veterinary sciences on a speciality 16.00.03 - veterinary microbiology and virology. Institute of experimental and clinical veterinary medicine UAAS, Kharkov, 2005. The thesis is devoted to studying of Marek's disease virus circulation in Ukrainian flock farms, field strains biological properties and development of diagnostics means of this disease. The results of virologic researches by virus indication in farms are described in this work. It there investigated above 370 clinical and pathological material samples from hens in unsuccessful through Marek's disease poultry farms, it were allocated 33 field isolates. 19 from them, according the results of PCR, were identified, as MDV of the first, 6 - the second and 8 - the third serotypes. The first serotype isolates were related to vv-, v-and m-pathotypes by the pathogenicity rout for chicken embryos and chickens. The methods specific viral antigens with activity up to 1:512 and hyperimmune serums production for the diagnostics of this disease in agar gel precipitation reaction were developed. According to the results Meq gene nucleotide sequence studying of 8 pathogenic and 4 vaccinal viral strains it has been established, that this site of viral genome is high conservative for pathogenic MDV 1 serotype. It was theoretically designed primers MDV-1, MDV-2, MDV-3 that MDV-4, flanked 321/286 bp region, a site which are offered for using oncogenic MDV-1 DNA detection. The test – system, created on their basis allows making detection of virus gene region in a clinical material with infectious activity of the causative agent 1 PFU/ml. Key words: Marek's disease, Marek's disease virus, biological properties, serotype, pathotype, agar gel precipitation reaction (AGP), antigen, serum, polymerase chain reaction (PCR), gene, primers. PAGE \* Arabic 23

Похожие записи