НАЦІОНАЛЬНА АКАДЕМІЯ НАУК УКРАЇНИ

ІНСТИТУТ ЕКСПЕРИМЕНТАЛЬНОЇ ПАТОЛОГІЇ, ОНКОЛОГІЇ І РАДІОБІОЛОГІЇ
ім.Р.Є.КАВЕЦЬКОГО

ПОГРІБНИЙ ПЕТРО ВАСИЛЬОВИЧ

УДК: 616-006.04:577.218

Дефенсини та регуляція активності рецептора епідермального фактора росту
в пухлинних клітинах людини

14.01.07 – онкологія

Автореферат

дисертації на здобуття наукового ступеня

доктора біологічних наук

Київ – 2004

Дисертацією є рукопис.

Робота виконана в Інституті експериментальної патології, онкології і
радіобіології ім.Р.Є.Кавецького НАН України.

Науковий консультант — член-кореспондент НАН України, доктор медичних
наук, професор Чехун Василь Федорович, директор Інституту
експериментальної патології, онкології і радіобіології ім.Р.Є.Кавецького
НАН України, завідувач відділу механізмів протипухлинної терапії;

Офіційні опоненти: — доктор біологічних наук, професор Гамалія Микола
Федорович, завідувач відділу клітинної фотобіології і фотомодуляції
пухлинного росту Інституту експериментальної патології, онкології і
радіобіології ім.Р.Є.Кавецького НАН України, м. Київ;

— доктор медичних наук Вакуленко Галина Олексіівна, доцент кафедри
онкології Національного медичного університету ім.О.О.Богомольця, м.
Київ;

— член-кореспондент НАН України, доктор біологічних наук, професор
Малюта Станіслав Станіславович, завідувач відділу молекулярної генетики
Інституту молекулярної біології і генетики НАН України, м. Київ.

Провідна установа — Львівський національний медичний університет ім.
Данила Галицького МОЗ України

Захист відбудеться “_14_” квітня 2004 р. о _13_ годині _30_ хвилин
на засіданні спеціалізованої вченої ради Д 26.155.01 в Інституті
експериментальної патології, онкології і радіобіології ім.Р.Є.Кавецького
НАН України (03022, Київ, вул.Васильківська, 45).

З дисертацією можна ознайомитись у бібліотеці ІЕПОР ім.Р.Є.Кавецького
НАН України.

Автореферат розісланий “____” березня 2004 р.

Вчений секретар

спеціалізованої вченої ради

доктор медичних наук
Н.В.Бородай

ЗАГАЛЬНА ХАРАКТЕРИСТИКА РОБОТИ

Актуальність проблеми. Злоякісна трансформація еукариотичних клітин є
наслідком мультифакторних порушень процесів проліферації та контролю
програмованої загибелі клітин. Дослідження білків/пептидів, що можуть
брати участь у таких процесах, привернули увагу до антимікробних
пептидів ссавців — дефенсинів. Дані останніх років свідчать про те, що
ці пептиди є не тільки антибіотиками і важливими компонентами системи
природженого імунітету, але багатофункціональними біомолекулами, які
концентраційно-залежним шляхом можуть впливати на сигнальну трансдукцію
та проліферацію клітин чи інгібувати синтез ДНК і викликати лізис клітин
(Murphy et al., 1993; Jacob еt al., 1994; Kamisz еt al., 2003;). Однак,
механізми такого впливу бета-дефенсинів залишаються недослідженими, а
білки-мішені – неідентифікованими.

У 2002 році Biragyn et al. встановили, що бета-дефенсин-2 людини (hBD-2)
може впливати на систему адаптивного імунітету і прямо активувати
дендритні клітини. Як речовини з потужними ад’ювантними властивостями,
дефенсини можуть впливати на здатність адаптивної імунної системи
впізнавати фрагменти білків клітин, у тому числі пухлинних. У зв’язку з
цим вони можуть бути використані у клініці не тільки як антибіотики для
поверхневого застосування, але і як компоненти протипухлинних вакцин.

В той же час експресія дефенсинів в пухлинах людини залишається майже не
дослідженою. Дані кількох груп вчених продемонстрували наявність
гіперекспресії бета-дефенсинів 1 та 2 в новоутвореннях ротової порожнини
людини та відсутність такої в пухлинах простати та нирки (Abico et al.,
1999, Mizukawa et al., 2000, Savaki et al., 2002, Donald et al.,
2003).

Для ефективного застосування дефенсинів в клінічній онкології
необхідними є фундаментальні обґрунтування механізмів впливу цих
антибіотиків на системи передачі сигналів в клітинах та ретельне
вивчення особливостей їх експресії в новоутвореннях людини, а також
можливий зв’язок дефенсинів з регуляцією активності рецептора
епідермального фактора росту (ЕФРр). Відомо, що ЕФРр відіграє критичну
роль як в нормальному, так і злоякісному рості клітин (Velu, 1990;
Tsanatis et al., 2000). Порушення функціонування ЕФРр спостерігаються в
пухлинах різних типів (Jacob et al., 1994). Згідно даних літератури, до
таких порушень відноситься поява конститутивно активованих мутантів
рецептора, гіперекспресія ЕФРр та його лігандів (ЕФР/ТФР-(), що
асоційовані з інвазивністю пухлин і впливають на їх чутливість до
протипухлинних агентів (Tahara et al., 1996; Keloff et al., 1996;
Hortobagyi, 2000; Tsanatis et al., 2000). У зв’язку з цим ЕФРр
розглядається як молекулярна мішень для створення нових ефективних
протипухлинних ліків, а використання специфічних інгібіторів кіназної
активності ЕФРр — як новий потенційно ефективний напрямок в хіміотерапії
онкологічних хворих (Raymond et al., 2000; Barton et al., 2001; Seymour,
2001). Дослідження ряду лабораторій світу протягом останніх років
присвячені інтенсивному пошуку та розробці специфічних природніх і
синтетичних інгібіторів протеїн тирозинкінази (ПТК) рецептора ЕФР
(Mendelsohn, 1997; Mendelsohn et al., 2000; Ciardiello et al., 2001).
Деякі такі сполуки, що продемонстрували високу антипроліферативну
активність in vitro, зараз знаходяться у І-ІІІ фазах клінічних
випробувань (Hirata et al., 2002).

У звязку з цим дослідження дефенсинів in vitro як можливих ефекторів
активності кінази ЕФРр в пухлинних клітинах та особливостей їх експресії
в новоутвореннях людини є важливим напрямком сучасної фундаментальної
онкології, що може знайти застосування в практичній медицині.

Зв’язок роботи з науковими програмами, планами і темами. Роботу виконано
у відділі біології пухлинної клітини Інституту експериментальної
патології, онкології і радіобіології ім.Р.Є.Кавецького НАН України.
Робота виконана в рамках програм ДКНТ України, Міністерства України у
справах науки і технологій (шифр 2/1297-97, № 0198U005252; шифр
02.04/04439, № 0198U005179) та в планах науково-дослідних робіт
Інституту експериментальної патології, онкології і радіобіології
ім.Р.Є.Кавецького НАН України, шифр проблеми 2.2.5.209, № 0198U001092).

Мета дослідження. Метою роботи було з’ясування ролі дефенсинів в
аутокринній регуляції активності рецептора ЕФР в пухлинних клітинах
людини.

Задачі дослідження:

Розробити експериментальні клітинні системи, що конститутивно
експресують рецептор ЕФР та контрольовано продукують рекомбінантний
ТФР-(, оцінити їх проліферативні показники в порівнянні з вихідними
лініями.

Дослідити особливості функціонування ЕФРр в отриманих експериментальних
клітинних системах.

Виділити пептиди з характеристиками інгібіторів кінази ЕФРр з
культурального середовища клітин і дослідитити їх властивості та
біологічну активність.

Отримати рекомбінантний бета-дефенсин-2 людини та моноклональні антитіла
до нього.

5. Дослідити експресію генів ЕФРр та дефенсинів в лініях пухлинних
клітин in vitro, встановити можливі функціональні взаємозв’язки між їх
білковими продуктами.

6. Провести аналіз експресії генів ЕФРр та дефенсинів в клітинах пухлин
шийки матки та вульви людини.

Об’єкт дослідження — прикріплені та суспензійні лінії клітин людини та
тварин: А431 (епідермоїдна карцинома вульви людини), M-HeLa (карцинома
шийки матки людини), КВ (епідермоїдна карцинома слизової оболонки
порожнини рота людини), COLO320HSR (аденокарцинома товстої кишки
людини), Mewo (злоякісна меланома людини), MCF-7 (фіброцистома молочної
залози людини), U251 (гліобластома людини), CESS (В-клітини людини,
трансформовані EBV), Molt-4 (Т-клітинний гострий лімфобластний лейкоз
людини), Raji (лімфома Беркітта людини), Namalwa (лімфома Беркітта
людини), Jurkat (Т-клітинна лімфома людини), СЕМ (Т-клітинний гострий
лімфобластний лейкоз), клітинні сублінії А431/1522 і M-HeLa/1522, що
отримано на основі ліній клітин А431 і M-HeLa в результаті їх
трансфекції кДНК трансформуючого фактора росту типу (; та зразки
хірургічно видалених тканин (умовно-нормальний та злоякісно
трансформований епітелій вульви та шийки матки людини).

Предмет дослідження — експресія ЕФРр та дефенсинів на рівні мРНК та
білку в злоякісно трансформованих епітеліальних клітинах людини.

Методи дослідження — для виділення та очищення білків та пептидів (ЕФР,
ТФР-(, hBD-2) в роботі було застосовано стандартні методи препаративної
біохімії, переважно хроматографічні (гель-фільтрація, іонообмінна
хроматографія, зворотньофазова хроматографія високого тиску),
ультрацентрифугування; для дослідження отриманих препаратів
використовували метод електрофорезу в градієнті поліакриламідного гелю;
для дослідження проліферативних показників культивованих клітин та
оцінки деяких показників трансфікованих клітинних субліній
використовували радіоізотопні методи; для характеристики білків/пептидів
та моноклональних антитіл застосовано імунохімічні методи дослідження
(Вестерн-блот аналіз, ELISA, імуноблотинг, імунопреципітація); для
вивчення експресії hBD-2 в пухлинах людини використовували
імуногістохімічні методи дослідження; для дослідження біологічної дії
ікЕФРр було застосовано функціональні, мікробіологічні, вірусологічні
методи дослідження; для отримання клітинних субліній, що
гіперекспресують ТФР-( та для отримання рекомбінантного hBD-2 було
застосовано генно-інженерні методи (клонування, трансфекція, експресія
продукту в еукариотичних та бактеріальних клітинах); для характеристики
продукту трансфекції, дослідження експресії мРНК різних генів, в тому
числі hBD-2 та ЕФРр, використовували молекулярно-біологічні методи
(виділення ДНК та РНК, рестриктний аналіз, Саузерн- та Нозерн-аналіз,
полімеразна ланцюгова реакція, полімеразна ланцюгова реакція із
зворотньою транскрипцією); для отримання анти-hBD-2–моноклональних
антитіл використовували стандартну гібридомну технологію з використанням
рекомбінантного hBD-2 в якості антигену.

Наукова новизна одержаних результатів. Вперше генно-інженерним шляхом
отримано сублінії клітин А431/1522 та M-HeLa/1522, що гіперекспресують
ТФР-(. Досліджено особливості функціонування ЕФР-залежної системи
контролю росту в цих клітинних сублініях. Показано, що гіперекспресія
ТФР-( в клітинах сублінії А431/1522 приводить до уповільнення
проліферації цих клітин. Встановлено, що клітини А431/1522 продукують
позаклітинно речовину, яка пригнічує активність кінази ЕФРр. Очищено
інгібітор кінази ікЕФРр та встановлено, що ікЕФРр є пептидним
антибіотиком людини — (-дефенсином-2 (hBD-2). Вперше показано, що цей
пептид має, окрім антимікробної активності, властивості інгібітора
цитозольних та трансмембранних кіназ, цитолітичну та гемолітичну
активності. Проведено аналіз експресії гена ікЕФРр (hBD-2) в пухлинних
клітинах людини та досліджено її регуляцію in vitro. Вперше
продемонстровано, що експресія гена hBD-2 є ТФР-(/ЕФР-залежною, а
білковий продукт цього гена пригнічує активність кінази ЕФРр. Проведено
аналіз спектра дефенсинів, що експресуються в пухлинних клітинах вульви
та шийки матки людини. Показано, що експресія гена hBD-2 є характерною
для пухлин цієї локалізації та асоційована з гіперекспресією гена ЕФРр.

Практичне значення одержаних результатів. Дослідження є завершеною
фундаментальною роботою, результати якої можуть бути використані в
практичній онкології. Запропонована технологія отримання hBD-2 в
препаративній кількості, що дозволить провести доклінічні випробування
пептиду в якості антибіотика для поверхневого застосування або
протипухлинного агента для лікування хворих з новоутвореннями жіночої
репродуктивної системи. Отримані моноклональні антитіла до hBD-2, які є
досконалим інструментом дослідження експресії цього пептиду в
новоутвореннях людини.

Особистий внесок здобувача. Дисертанту належить ідея отримання
генно-інженерним шляхом субліній клітин А431 та М-HeLa, що
гіперекспресують ТФР-(. Він дослідив біологічно-активні пептиди та
білки, що продукуються цими клітинами. Автор самостійно провів
біохімічні та імунохімічні дослідження пептиду з властивостями
інгібітора кінази ЕФР-рецептора, генетичні дослідження експресії генів
дефенсинів in vitro та в клінічному матеріалі. Автор самостійно
аналізував весь отриманий матеріал, формулював усі положення та висновки
роботи, готував до друку публікації, що відображають результати
дисертації.

Апробація роботи. Матеріали роботи було представлено та обговорено на :

І-й науково-практичній конференції з проблем ВІЛ/СНІД (Київ, Україна,
1995); 7-му Європейському конгресі з Біотехнології (Ніца, Франція,
1995); Першому Європейському Симпозіумі Білкового товариства (Давос,
Швейцарія, 1995); 8-му Європейському конгресі з біотехнології (Будапешт,
Угорщина, 1997); Міжнародних курсах EMBO/FEBS/UNESCO ‘Молекулярні основи
бактеріальної інфекції’ (Спецес, Греція, 1998); 26-му симпозіумі
Федерації Європейського біохімічного товариства (Ніцца, Франція, 1999);
ІІ з’їзді онкологів країн СНД “Онкологія 2000” (Київ, Україна, 2000);
18-му Міжнародному Конгресі з біохімії та молекулярної біології
(Бірмінгем, Великобританія, 2000); 3-й Міжнародній конференції “
Mechanisms of cellular signal transduction and communication” (Львів,
Україна, 2000); Міжнародному симпозіумі “Intracellular signalling in
plant and animal systems (ISPAS)” (Київ, Україна, 2001); 10-му з’їзді
онкологів України (Ялта, Україна, 2001); 4th Parnas Conference
“Molecular mechanisms of cell activation: biological signals and their
target enzymes (Вроцлав, Польща, 2002); IV науково-практичній
конференції “Сучасні принципи діагностики та лікування візуальних форм
генітального раку у жінок” (Львів, Україна, 2002).

Публікації. Основний зміст дисертаційної роботи викладений в 35
публікаціях, в тому числі в 24 журнальних статтях у провідних фахових
виданнях серед яких одна самостійна, та у 10 тезах матеріалів
вітчизняних та міжнародних конгресів, конференцій, з’їздів.

Структура та обсяг дисертації. Дисертацію викладено на 284 сторінках
машинописного тексту. Дисертація складається із вступу, 2 розділів
огляду літератури, 9 розділів власних досліджень, аналізу та узагальнень
результатів досліджень, висновків і списку цитованої літератури.
Дисертація містить 15 таблиць і 77 рисунки. Список використаних джерел
включає 299 найменувань, з них 12 — на українській та російській мовах,
287 — на англійській мові.

ОСНОВНИЙ ЗМІСТ РОБОТИ

Матеріали та методи дослідження. В експериментах було використано лінії
клітин А431 (епідермоїдна карцинома вульви людини), M-HeLa (карцинома
шийки матки людини) та клітинні сублінії А431/1522 і M-HeLa/1522, що
отримані шляхом трансфекції ліній клітин А431 і M-HeLa ретровірусним
вектором 1522. кДНК ТФР-( розміром 1,3 т.н.п. в плазміді 1522 клоновано
по сайтах рестрикції EcoR I. Всі клітини вирощували у середовищах DMEM
або RPMI-1640, що містили 10% ембріональної телячої сироватки (ЕТС)
(Gibco BRL, Великобританія) у насиченій вологою атмосфері з 5% СО2.
Експресію кДНК ТФР-( в сублініях клітин А431/1522 і M-HeLa/1522 по
досягненні конфлюентного моношару індукували шляхом зміни середовища на
таке, що не містить фенолового червоного з 1,5 — 3 мкМ CdCl2 , після
чого клітини інкубували протягом 48 год без сироватки. Кондиційоване
середовище (К-середовище) після інкубації клітин збирали для
використання в подальших експериментах.

Для визначення антимікробної активності препаратів використовували
культури бактерій і грибів, отримані з Української колекції
мікроорганізмів Інституту мікробіології та вірусології ім. Д.К.
Заболотного НАН України. Реципієнтний штам E.coli HB101, трансформований
рекомбінантною плазмідою 1522 (McGeady, 1989), був люб’язно наданий
професором D. Salomon (Лабораторія біології та імунології раку,
Національний Інститут Раку, Бетезда, США).

В дослідженнях використано клінічний матеріал після хірургічного
видалення первинних пухлин вульви та шийки матки, отриманий у відділенні
онкогінекології Інституту онкології АМН України (зав. науково-дослідним
відділенням, професор Л.І.Воробьова). Досліджено післяопераційний
матеріал 40 хворих ( 25 хворих на рак вульви та 15 на рак шийки матки).
За клінічними та гістологічними ознаками пухлини були верифіковані як
плоскоклітинний рак I-ої, II-ої та III-ої стадії. Визначення стадій
проводили за класифікацією TNM (1997).

Для виділення та очищення білків та пептидів (ЕФР, ТФР-(, інгібітор
кінази ЕФРр (ікЕФРр)) в роботі застосовано стандартні методи
препаративної біохімії, переважно хроматографічні, низькошвидкісне та
ультрацентрифугування. Для дослідження отриманих препаратів
використовували метод електрофорезу в градієнті поліакріламідного гелю,
Вестерн-блот аналіз та радіоізотопні методи.

Очищення ТФР-( проводили шляхом хроматографії на міні-колонці Sep-Pak
C18 (Kumar, 1990) з подальшим використанням напівпрепаративної та
аналітичної рідинної хроматографії високого тиску в оберненій фазі.

Для виділення ікЕФРр К-середовище клітинних культур центрифугували,
ліофілізували та застосовували послідовність хроматографічних процедур,
в яких критерієм відбору фракцій на проміжних стадіях очищення була
наявність бактерицидної активності по відношенню до Bacillus subtilis.
Активні фракції об’єднували, концентрували за допомогою міні-колонок
Sep-Pak C18 та проводили послідовно гель-фільтрацію високого тиску на
колонці ТSK-GEL Toyopearl HW-40 (Toyo Soda, Японія), рідинну
хроматографію високого тиску в оберненій фазі (ОФ РХВТ) та
рехроматографію на колонці Ultrasphere ODS 5m (Beckman, США).
Гомогенність та чистоту отриманого препарату перевіряли методом
електрофорезу в редукуючих умовах (Леммлі, 1970).

Для отримання 125І-ЕФР проводили йодування за методом Грінвуда (1963),
використовуючи як зв’язуючий агент хлорамін Т. Радіоактивність осадів
визначали на гамма-лічильнику ‘Гамма-1”(СРСР).

Для отримання препаратів плазматичних мембран з культивованих клітин
використовували метод Payrastre (1991).

Визначення фосфокіназної активності білків клітин та препаратів
плазматичних мебран проводили з використанням [32P]-(-АТФ за
стандартними методиками (Иващенко, 1986). В ряді випадків після реакції
фосфорилювання білки розділяли електрофорезом в поліакріламідному гелі,
проводили перенос на нітроцелюлозні мембрани та використовували метод
імуноблотингу (Вестерн-блот-аналіз) з застосуванням
анти-фосфотирозинових антитіл.

Для Вестерн блотингу, що проводився за стандартною схемою, білки після
електрофорезу в поліакриламідному гелі в присутності ДСН переносили на
нітроцелюлозну мембрану (Schleicher&Schull, Німеччина) та проявляли з
використанням 4-хлор-1-нафтолу, як субстрату для пероксидази, або набору
реактивів ECL (Amersham, Англія).

Ковалентне зв’язування 125І-ЕФР проводили відповідно до протоколу
Иващенко Ю.Д. (1986) з використанням зшиваючого реагента
біссульфосукцинімідилсуберату (Pierce, США).

Електрофорез білків з додецилсульфатом натрію проводили у вертикальних
пластинах, в системі буферів Леммлі (1970), в 7-22% або 15-22%
градієнтних поліакриламідних гелях, використовуючи апарати “Біорух”
(Україна). При необхідності візуалізації низькомолекулярних білків та
пептидів зразки розділяли електрофоретично з використанням
Тріс/Тріцинового буфера (Liu, 1999) або оцтової кислоти з додаванням
сечовини (Остерман, 1983). Гелі після електрофорезу забарвлювали
діамантовим синім Coomassie G250 або азотнокислим сріблом (Deutscher,
1990). Ізоелектричну точку пептидів визначали за стандартною методикою
(Deutscher, 1990; Остерман, 1983).

Забарвлені поліакриламідні гелі висушували під вакуумом на апараті
“Гель-1” (СРСР) і в випадках радіоактивно мічених зразків експонували
від 20 хв до 5 діб (в залежності від активності проб) при -20оС з
рентгенівською плівкою KODAK BioMax або KODAK XAR (Eastman Kodak, США) в
касеті з підсилюючим екраном Hyperscreen (Amersham, Великобританія).

Визначення концентрації білку проводили за методом, розробленим
Greenberg i Craddock (1982).

За основу при міченні клітин 35S-метіоніном та імунопреципітації було
взято протоколи, запропоновані Weber та Gill (1984).

Для дослідження впливу ікЕФРр на активність цитозольних протеїнкіназ,
для імунопреципітації протеїнкіназ і їх фосфорилювання in vitro за
основу було взято протокол Law (1984).

Кількість та афінність молекул ЕФРр на поверхні клітин оцінювали за
допомогою ПАП-методу (пероксидаза-антипероксидаза) з використанням
моноклональних антитіл (МКАТ), вторинних кролячих антитіл проти Ig мишей
та ПАП комплексу (Пинчук В.Г. и др. 1990). Аналіз та обробку препаратів
проводили з використанням світлового мікроскопу і програми Statistika
3.0, яка дозволила проводити розрахунки для груп середніх (М) та похибок
середніх арифметичних (м).

Для визначення гемолітичної активності ікЕФРр досліджували лізис
еритроцитів в шарі агарози. Суспензію еритроцитів заливали у 70 мм
пластикові чашки Петрі (Росія), після чого в шарі агарози пробивали
лунки діаметром 3 мм, куди вносили тестований матеріал в серійному
розведенні. Після інкубації при 30оС протягом 5 год вимірювали діаметр
зон гемолізу і обчислювали залежність площі зони від логарифму
концентрації ефектора.

Для оцінки впливу пептиду на проліферативну активність культивованих
клітин застосовано варіант методу, основаного на включенні міченого
тимідину в ДНК клітин, що використовується для визначення
бласт-трансформації лімфоцитів згідно методу Тессенова (1979).
Активність проб визначали на рідинному сцинцілляційному лічильнику
Intertechnique SL-30 (Франція).

Дослідження впливу hBD-2 на крупноблочну фрагментацію геномної ДНК в
пухлинних клітинах проводили, як описано в роботі Heller (1989).

Для отримання клонів клітин, що гіперекспресують ТФР-(, було використано
лінії клітин людини А431 та М-HeLa. Введення провірусної ДНК в клітини
РА317 здійснювали методом електротрансфекції (Neumann, 1982; Агаркова,
1987) з подальшою селекцією клітин, що продукують рекомбінантні вірусні
частинки. Клітини інфікували та проводили клонування і селекцію з G418
(Gibco, Великобританія).

Плазмідну ДНК виділяли шляхом екстракції сумішшю фенол-хлороформ (1:1),
як описано Birnboim (1983). Препарат плазмідної ДНК зберігали в етанолі
при -20оС.

ДНК-зонди мітили за допомогою набору для нік-трансляції та [32P]-dCTP
(Amerscham,CША), враховуючи рекомендації фірми-виробника. Виділення
фрагментів ДНК, що включили [32P] dNTP, проводили на хроматографічній
колонці з сефадексом G-50. Радіоактивність зонду вимірювали за допомогою
рідинного сцинтиляційного лічильника LS 30 (Intertechnigue, Франція).

Виділення сумарної РНК з культивованих клітин та післяопераційного
матеріалу проводили за методом P.Chomczynski (1987). Концентрацію та
ступінь чистоти зразку РНК визначали на спектрофотометрі Beckman DU-8B
та в 1% агарозному гелі, що містив 20% формальдегіду.

Геномну ДНК виділяли за модифікованим методом Johns (1989).

Елюцію ДНК з поліакриламідних гелів проводили шляхом дифузії, з
агарозних гелів – плавленням із застосуванням набору Gene Clean №3105 (
BIO 101, Inc., Канада) згідно з протоколом фірми-виробника. Очистку ДНК
проводили стандартним фенол-хлороформним методом (Маниатис, 1984).

Нозерн- та Саузерн-блот-гібридизацію нуклеїнових кислот проводили
згідно протоколу Маниатиса (1984) з використанням [32Р]-мічених зондів.

Полімеразну ланцюгову реакцію (ПЛР) проводили з використанням ПЛР буферу
та термостабільної Taq-полімерази виробництва Fermentas (Литва) за
принципом “Hot Start”. Аналіз ампліфікованої ДНК здійснювали
використовуючи метод електрофорезу.

Послідовність олігонуклеотидних затравок добиралась за допомогою
комп’ютерної програми Oligo з використанням даних про нуклеотидну
послідовність генів, що досліджувались, та їх мРНК, отриманих з
генетичного банку даних на Internet-сайті Американського Центру
Біотехнологічної Інформації (www.ncbi.nlm.nih.gov). Оптимальні умови
ампліфікації для кожної пари олігонуклеотидних затравок підбирались в
експерименті на геномній ДНК людини, виходячи з теоретично передбачених
за допомогою програми Oligo.

Реакцію зворотньої транскрипції (ЗТ-ПЛР) проводили в об’ємі 20 мкл з
використанням набору для синтезу кДНК RevertAidTM, First Strand cDNA
Synthesis Kit (№К1621, Fermentas, Литва). Синтезовану кДНК зберігали при
200С.

Для перевірки генетичної належності фрагментів ДНК, отриманих в
результаті полімеразної ланцюгової реакції, проводили реакцію рестрикції
з використанням ендонуклеаз рестрикції AluI, BstNI, DdeI, EcoRI, HaeIII,
HincII, MspI (Маниатис, 1984).

Для аналізу виділеної та синтезованої в умовах ПЛР ДНК використовували
методи електрофорезу в горизонтальному агарозному та вертикальному
поліакриламідному гелях. Після проведення електрофорезу ДНК детектували
в ультрафіолетовому світлі на трансілюмінаторі.

Антимікробну активність препаратів визначали за пригніченням росту
бактерій в тонкому шарі агарози за модифікованим методом Hultmark
(1983). Для визначення мінімальної інгібіторної концентрації ікЕФРр
використовували серійні розведення досліджуваних пептидних зразків.
Летальну концентрацію пептиду визначали екстраполяцією лінійної
залежності на нульове значення площі зони лізису. Аналогічно тестували
активність пептидів проти грибів, що висівали на сусло-агар.

Дослідження впливу вірусної інфекції на експресію генів дефенсинів in
vitro проводили стандартним методом інфікування клітин А431 еталонним
штамом аденовірусу 5 типу (Носач, 1982). Аналіз вірус-специфічних
включень аналізували, використовуючи люмінісцентний мікроскоп МЛ-2
(ЛОМО, Росія).

Для клонування гена hBD-2 було обрано вектор pGEX-2T. Олігонуклеотидні
затравки були наступного складу: 5` — gtgttggatccggtataggcgatcctgttacctg
– пряма, 5` — tcttggaattctcatggctttttgcagcattttg – зворотня.
Ампліфікацію фрагмента кДНК гена hBD-2 для клонування проводили на кДНК,
отриманої в результаті ЗТ-ПЛР. Культивування бактерій, очистку
плазмідної ДНК, реакції рестрикції та лігування, проводили за
стандартними методиками (Маниатис, 1984). Для отримання продуцента
рекомбінантного hBD-2, в складі химерного білку (злитого з
глутатіон-S-трансферазою (GST), використовували штам E.coli XL-Gold.
Відбір рекомбінантних колоній на наявність вставки фрагмента кДНК гена
hBD-2 проводили шляхом скринінгу плазмідної ДНК методом ПЛР та
рестриктним аналізом. Рекомбінантні плазміди просиквеновані з метою
виявлення можливих помилок в послідовності кДНК гена hBD-2 та згідно
сиквенсу відібрано клон, що використовувався в подальшій роботі.

Очистку рекомбінантного hBD-2 з лізату клітин E.coli XL-Gold, попередньо
індукованих IПTГ, проводили шляхом афінної хроматографії на колонці з
глутатіон-НT-сефарозою. Після протеолізу химерного білку тромбіном
(Sigma, США), hBD-2 очищали методом іонообмінної хроматографії на
колонці MonoSP.

Гібридому, що секретує моноклональні антитіла до hBD-2, отримано в
результаті соматичної гібридизації спленоцитів мишей лінії BALB/c з
клітинами мишиної мієломи SP2/0. Було використано варіант довгострокової
імунізації із залученням рекомбінантного hBD-2. Через три доби після
останньої імунізації проводили гібридизацію клітин селезінки з клітинами
мієломи з використанням 50% поліетиленгліколю (PEG-1500) в 1мМ NaOH за
методом Davidson R. тa Gerald P. (1978). Після селекції клітинних
гібридів у ГАТ та ГТ середовищах скринінг продукції специфічних антитіл
здійснювали методами ELISA та Вестерн-блотингу. Після клонування,
реклонування і культивування in vitro було відібрано клон гібридоми, що
активно продукує антитіла до hBD-2.

Імуногістохімічні дослідження проводили на парафінових зрізах за схемою
непрямого методу виявлення антигенів із застосуванням авідин —
біотинової системи та пероксидази в якості ферментної мітки згідно
стандартних протоколів. Для блокування ендогенної пероксидази
застосували 0,3 % розчин перекису водню протягом 30 хвилин, розведення
антитіл — 1/2000. Дослідження проводили за допомогою мікроскопу Axioplan
(Zeiss, Німеччина) із застосуванням імерсійного об`єктиву (х100).
Система вводу зображень складалася з відеокамери Sony DXC-151AP із
композитним відеовиходом, плати відеовходу EZ Capture, комп`ютера
Pentium III та програми аналізу зображень ImagePro (Media Cybernetic,
США). Обробку даних проводили за допомогою програми Statistika 3.0.

Статистичну обробку результатів досліджень проводили в пакетах програм
Origin 5.0 i GraphPad Prism 2.0. Цифровий матеріал, що наведено в
дисертаційній роботі, підлягав варіаційно-статистичній обробці (Урбах,
1975). Результати вважали достовірними при коефіцієнті вірогідності Р (
0,05.

РЕЗУЛЬТАТИ ДОСЛІДЖЕНЬ ТА ЇХ ОБГОВОРЕННЯ

Для створення експериментальних моделей регульованої експресії
трансформуючого фактору росту in vitro було обрано лінії клітин А431 та
М-HeLa, які відрізняються за кількістю рецепторів ЕФР (А-431 – 2х106
молекул ЕФРр/кл., М- HeLa – 105 ЕФРр/кл.). Для клонування
використовували ретровірусний вектор 1522, що являє собою рекомбінантну
конструкцію, до складу якої входить індуцибельний металотіонеїновий
промотор миші (МТ-1), кДНК ТФР-( людини та ген
аміноглікозидфосфотрансферази, яка інактивує антибіотик G418. Селекцією
на G418 було відібрано клони-продуценти ТФР-(, які далі тестували в
конкурентному варіанті радіорецепторного аналізу з використанням в
якості ліганда [125І]-ЕФР. В результаті проведеного скринінгу було
відібрано клони А431/1522-4 (далі – А431/1522) та M-HeLa/1522-25 (далі
–M-HeLa/1522), що мали найменшу кількість вільних рецепторів ЕФРр.

Дослідження показали, що в геном клітин клону А431/1522 інтегровано не
менш однієї копії гена ТФР-(, експресія якого залежить від присутності в
середовищі хлорида кадмію (оптимальна концентрація CdCl2 — 3 мкМ) і
сягає максимуму на другу добу інкубації клітин з іонами кадмію. За таких
умов спостерігається транскрипція гена ТФР-( та його синтез.
Рекомбінантний ТФР-( (рТФР-() утворюється як в зрілій формі, що
продукується позаклітинно, так і в формі недопроцесованого
мембранозв’язаного попередника. Обидві ці форми є активними і здатні
зв’язуватися з ЕФРр та активувати його аутофосфорилювання. Продукція
рекомбінантного ТФР-( призводить до зниження кількості ЕФРр на поверхні
клітин та до прискорення процесів інтерналізації та екстерналізації
молекул рецептора. Клітини клону А431/1522 експресують в К-середовище
ТФР-( в кількості близько 30-40 нг/млн клітин, що в 3-4 рази більше, ніж
в клітинах вихідної лінії. Однак швидкість проліферації клітин
А431/1522, що були індуковані іонами CdCl2, виявилась нижчою на 40% в
порівнянні з неіндукованими клітинами (Рис.1а), а фосфорилювання ЕФРр та
ряду білків знижено в 2 рази (Рис. 1б).

Рис. 1 а) включення [3Н]-тимідину в ДНК клітин А431 (1) та А431/1522
(2); б) фосфорилювання білків плазматичних мембран клітин А431 (трек 2)
та А431/1522 (трек 4).

Ці дані дали підставу для припущення, що в клітинах А431/1522 за умов
продукції рек-ТФР-( індуковано експресію біологічно активної речовини з
властивостями інгібітора кінази ЕФРр. У зв’язку з цим біохімічними
методами досліджено компоненти К-середовищ клітин А431/1522 та
M-HeLa/1522 і отримана фракція низькомолекулярних білків, аналіз яких
показав, що клітини субліній А431/1522 та M-HeLa/1522 на відміну від
вихідних клітин (А431, M-HeLa) за умов індукції експресії рТФР-(
позаклітинно секретують позитивно-заряджений гідрофобний пептид. Цей
пептид здатний пригнічувати аутофосфорилювання рецептора ЕФР, має
властивості мембранно-активної речовини і не проявляє ЕФР-конкурентної
активності.

Здатність пептида інгібувати активність кінази рецептора ЕФР (ікЕФРр)
вказували на можливість його потенційної спорідненості з дефенсинами –
пептидними антибіотиками ссавців. Очистка пептидів на Sep-Pak C18
показала наявність в К-середовищі клітин сублінії А431/1522, індукованих
іонами CdCl2, антимікробної активності як проти грам-позитивних
(B.subtilis), так і грам-негативних (P.aeruginosa) мікроорганізмів
(Рис.2).

Рис.2. Антимікробна активність К-середовища клітин А431/1522 проти В.
subtilis (а) та P.aeruginosa (б) (лунки 1 – контроль; 2 – клітини, які
не індуковані CdCl2,; 3 – клітини, які індуковані CdCl2).

Таким чином, це дослідження підтвердило спорідненість ікЕФРр з
дефенсинами і дало підстави впровадити антимікробний тест Hultmark et
al. на всіх стадіях очистки ікЕФРр для моніторингу цього пептиду. Беручи
до уваги наведені в літературі схеми очищення антимікробних пептидів
тварин, було відпрацьовано оптимальну схему виділення пептиду за
допомогою хроматографічних методів. Ця схема передбачала такі етапи: 1)
гель-фільтрація низького тиску; 2) хроматографія на міні-колонці Sep-Pak
C18; 3) гель-фільтрація високого тиску; 4) рідинна хроматографія
високого тиску в оберненій фазі (ОФ РХВТ) з наступною рехроматографією
для повної очистки пептиду.

Після рехроматографії було отримано 3 фракції, що містили антимікробну
активність та елюювались 62%-им, 65%-им та 67%-им ацетонітрилом.
Інгібіторну активність проти кінази рецептора ЕФР реєстрували тільки у
фракції, що елюювали 65%-ним ацетонітрилом (пік IІ) (Рис.3). Піки І та
ІІІ, що були активними в тесті Hultmark et al., не інгібували активність
кінази рецептора ЕФР.

Для ідентифікації піку І, одержаного після рехроматографії в оберненій
фазі, було проведено його мас-спектрометричний аналіз. Порівняння
результатів мас-спектрометричного аналізу піку I з опублікованими даними
дозволили встановити, що отриманий нами антимікробний пептид є
ідентичним до (-дефенсину-1 людини (hBD-1).

Для ідентифікації пептиду піку II була з’ясована його часткова
N-кінцева амінокислотна послідовність. В результаті проведених
досліджень вдалося ідентифікувати послідовність перших семи N-кінцевих
амінокислот Gly—Ile—Gly—Asp—Pro—Val—Thr, яка повністью відповідає
відомій послідовністі (-дефенсину-2 (hBD-2). Отримані результати
дозволяють стверджувати, що пептид ІІ піку є ідентичним (-дефенсину-2
людини з молекулярною масою 4,3 кДа.

Рис. 3. Профілі елюції при очистці ікЕФРр за допомогою ОФ РХВТ на
колонці Pep-RPC 5/5 C2-C18 (a) і рехроматографії фракції Х на колонці
Ultrasphere ODS (б); в – електрофореграма пептиду піку ІІ (трек 1; трек
2 – маркери молекулярної маси: 120, 97, 68, 43, 29, 18, 14, 12, 6 кДа).

Наступною задачею даної роботи було дослідження спектру біологічної
активності пептиду ікЕФРр (далі – hBD-2). Для з’ясування можливої
біологічної активності hBD-2 було досліджено його дію на бактерії,
культивовані клітини та еритроцити людини в суспензії, вплив на
активність протеїнкіназ, виділених з клітин, та на морфо-фізіологічний
стан хромосомної ДНК еукаріотичних клітин. В усіх випадках було
використано пептид, очищений рехроматографією в ОФ-РХВТ.

Для оцінки спектру антимікробної дії hBD-2 було визначено активність
пептиду по відношенню до ряду грам-позитивних і грам-негативних бактерій
і грибів. Отримані дані продемонстрували, що hBD-2 є токсичним для
різних штамів грам-позитивних та грам-негативних бактерій в
мікромолярному діапазоні концентрацій (Табл. 1). В диапазоні
концентрацій 100 — 200 мкМ hBD-2 пригнічував ріст грибів Fusarium
graminearum, Penicillium griseus, Mucor plumbum; фунгістатичної дії по
відношенню до Candida albicans відзначено не було.

Таблиця 1

Антибактеріальна активність пептиду hBD-2

Назва штаму бактерії Значення ІС, мкМ

Bacillus subtilis ATCC 6633 1,0 + 0,12

Bacillus subtilis ATCC 31029 1,2 + 0,14

Staphylococcus aureus P-209 1,5 + 0,14

Staphylococcus aureus ATCC 25923 1,2 + 0,14

Micrococcus luteus ATCC 10240 16,0 + 1,20

Pseudomonas aeruginosa ATCC 10145 3,6 + 0,22

Escherichia coli K12 (()? 0,3 + 0,10

Escherichia coli ATCC 25922 >150

Proteus vulgaris ATCC 13315 100 – 150

Далі було досліджено вплив hBD-2 на активність кінази рецептора ЕФР і на
деякі цитоплазматичні кінази. Отримані дані показали, що пригнічення
аутофосфорилювання ЕФРр в присутності hBD-2 має концентраційно-залежний
характер, концентрація hBD-2, що дорівнює 2 х 10-7 М, призводить до
зниження рівня аутофосфорилювання ЕФРр ~ в 2 рази (Рис.4).

Рис. 4. Залежність рівня фосфорилювання ЕФРр в препаратах плазматичних
мембран клітин лінії А431 від концентрації hBD-2 в пробі.

Дослідження впливу hBD-2 на імунопреципітовані цитозольні та
мембраноасоційовані протеїнкінази PKC(,?? Lyn і Syk in vitro показали,
що hBD-2 в концентрації 2 х 10-7 М пригнічує активність PKC( на 91%,
ізоформи Lyn з молекулярною масою 56 і 53 кД – на 70% і на 42%,
відповідно, Syk – на 18%.

З даних літератури відомо, що всі пептидні антибіотики ссавців у певних
концентраціях є токсичними. У зв’язку з цим було проведено тестування
hBD-2 на гемолітичну активность, а також його впливу на проліферативну
активність клітин лімфоцитарного походження. Були використані
суспензійні культури клітин ліній Namalwa i Jurkat. Вплив hBD-2 на
синтез ДНК в культивованих клітинах оцінювали за включенням тимідину,
міченого тритієм, в клітини, що були інкубовані при різних концентраціях
hBD-2 протягом 16 год.

Отримані дані показали, що в концентраціях 6-10-8 -5 х 10-7 М hBD-2
пригнічує синтез ДНК в культивованих клітинах, в концентраціях нижчих
5х10-8 М — стимулює проліферацію клітин, а в концентрації вищій ніж 5 х
10-6 М -викликає швидку загибель клітин in vitro. Більш того, 5 хв
інкубація клітин А431 в присутності 5 мкМ hBD-2 призводила до
крупноблочної фрагментації ДНК (появи фрагментів ДНК розміром приблизно
50 т.н.п.).

При дослідженні лізису еритроцитів людини було встановлено, що hBD-2
здатний викликати лізис еритроцитів в концентрації приблизно 10-7 М.

Результати досліджень довели, що трансформовані клітини в культурі
продукують суміш пептидів з антимікробною активністю. Для дослідження
транскрипції антимікробних пептидів, що продукуються в культурі клітин,
та регуляції їх експресії необхідно було використовувати інші методи,
які є більш точними та менш затратними, ніж біохімічні. За цих обставин
надалі було застосовано сучасні генетичні методи дослідження, що
дозволяють реєструвати експресію генів, – реакцію зворотньої
транскрипції (ЗТ-ПЛР) та метод ланцюгової полімеразної реакції (ПЛР).

Для дослідження експресії генів дефенсинів, ЕФРр, ТФР-( шляхом виявлення
відповідної мРНК методом ЗТ-ПЛР було підібрано олігонуклеотидні затравки
до кожного з досліджуваних генів та оптимальні умови їх ампліфікації
(Табл.2).

J

L

„o

y^„o

„o

y^„o

y^„

„o

y^„o

&

???

&

?

»

»

b

f

c

¤

^

`

|

a

J

J

J

J

J

J

J

J

J

J

iTHIEE1/21/2Eµµ?

3HD-6 — в культурах клітин Т-клітинного гострого лімфобластного лейкозу
людини Molt-4 та CЕM; 5) HNP-1, HNP-3 — в культурі клітин гліобластоми
людини U251.

Таблиця 2

Послідовності праймерів та розміри продуктів ПЛР та ЗТ-ПЛР

Ген Послідовність праймера Розмір продукту, п.н.

ПЛР ЗТ-ПЛР

HNP-1, HNP-3 5(-ccctcgccatccttgctgccatt

5(-gcaagctcagcagcagaatgccca 864 284

hBD-1 5(-tgttgcctgccagtcgccatgag

5(-tcacttgcagcacttggccttccc 7186 225

hBD-2 5(-gaagctcccagccatcagcc

5(-gtcgcacgtctctgatgaggga 1922 281

НР-4 5(-ccccagccatgaggattatcgcc

5(-ccatgccccttgttgagcctgaa 784 198

HD-5 5(-ccatcgccatccttgctgcca

5(-ggactcacgggtagcacaacggc 1196 224

HD-6 5(-aggctgatgcccaggagcag

5(-tggcaatgtatgggacacacga 1194 280

ТФР-( 5(-agtgcagacccgcccgtggct

5(-agggcgctgggcttctcgtgc

347

ЕФРp 5(-ctgct(c/g/t)aactgg(t/g)g(t/a)(g/a)t(g/a/c)ca(g/a)

at(a/t/c)gc(t/c/a)aaggg

5(-atcatcca(a/g)ca(c/t)ttgaccat(g/c)a(t/c)catgta(a/g)ac(g/a)tc

418

HPV 5(-cgtccmarrggawactgatc (P.E. №808-0011)

5(-gcmcagggwcataayaatgg (P.E. №808-0012)

450

G3PDH 5(-tgaaggtcggagtcaacggatttggt

5(-catgtgggccatgaggtccaccac

982

Визначення фрагментів кДНК дефенсинів лише після 40 циклів ампліфікації
свідчило про невисокий рівень експресії цих генів в клітинах
вищезгаданих ліній. Експресія гена HD-6 в клітинах СЕМ та Molt-4, а
також експресія генів HNP-1 та HNP-3 в клітинах гліобластоми U251 була
виявлена вперше в клітинах такого типу (Табл. 3).

На основі отриманих даних можна зробити припущення про
дерегуляцію/блокування нормальної експресії генів дефенсинів в злоякісно
трансформованих клітинах.

Таблиця 3

Експресія генів дефенсинів в культурах пухлинних клітин людини

Лінії клітин Гени

HNP-1/3 HBD-1 HBD-2 HP-4 HD-5 HD-6

A431 — + — — — +

M-HeLa — — — — — +

Colo320HSR — — — — + —

Molt-4 — — — — — +

CЕM — — — — — +

KB — + — — — +

U251 + — — — — —

Примітка: /+/ — наявність експресії гена

/-/ — експресії гена не зафіксовано

Згідно даних літератури рівень експресії генів ?-дефенсинів та hBD-1 має
конститутивний характер, а експресія гена hBD-2 є стимул-залежною і може
бути індукована у відповідь на мікробну інфекцію внаслідок контакту з
бактеріальними агентами чи ЛПС. У зв’язку з цим було проведено
дослідження, що мало за мету встановлення впливу бактеріальних агентів
на рівень експресії генів дефенсинів in vitro в лініях пухлинних клітин
А431 та M-HeLa. Цими дослідженнями встановлено, що 6 годинна інкубація
клітин А431 або M-HeLa з живими або стерилізованими кип’ятінням
клітинами B.subtilis (2,5 x 109 клітин) призводить до індукції експресії
мРНК hBD-2, але не впливає на рівні експресії генів hBD-1 та HD-6 в цих
клітинах (Рис. 5).

Рис. 5. Експресія генів hBD-2 (а), hBD-1 (б), HD-6 (в) та G3PDH (г) в
культурах клітин А431 за умов 6-год інкубації з стерилізованими
кип’ятінням (трек 2 ) та живими клітинами (трек 3). Трек 1 – контроль
(клітини А431).

Таким чином, отримані дані підтвердили, що експресія генів hBD-1 та HD-6
є конститутивною та не залежить від наявності зовнішніх стимулів, в той
час як наслідком бактеріальної інфекціі є індукція експресії гена hBD-2,
а вірусна інфекція не впливає на експресію цього гена.

Задачею даної роботи було також дослідити, як впливає вірусна інфекція
на експресію генів дефенсинів in vitro. Дані літератури відносно
противірусної дії дефенсинів малочисельні. В той же час найпоширеніші
форми раку у жінок (а саме плоскоклітинний рак шийки матки та вульви),
згідно сучасних поглядів, асоційовані з інфекцією певними серотипами
папіломних вірусів. Клітинні лінії А431 та M-HeLa, як відомо, мають
походження із злоякісних новоутворень вульви та шийки матки людини
відповідно. Методом ПЛР з використанням вироджених праймерів до ДНК
вірусів HPV була підтверджена наявність вірусної ДНК в геномі клітин
лінії M-HeLa. Як і передбачалось, ЗТ-ПЛР дала негативну відповідь.
Тобто, за нормальних умов культивування та за умов культивування клітин
з культурою B.subtilis вірус папіломи в цих клітинах перебуває в стані
провірусу та не транскрибується.

Отримані дані показали, що продукція рекомбінантного ТФР-( клітинами
клону А431/1522 індукує секрецію антимікробного пептиду з властивостями
інгібітора кінази ЕФРp. Біохімічними методами було встановлено, що
досліджуваний пептид є бета-дефенсином-2 людини. Для підтвердження цих
даних було проведено дослідження спектру експресії мРНК дефенсинів
клітин А431/1522 при культивуванні з 3 мкМ Cd2+ протягом 1, 3, 6, 9 та
12 год. Після проведення ЗТ-ПЛР було встановлено, що починаючи з 6
години такої інкубації клітини А431/1522 експресують мРНК hBD-2 (Рис.
6,а). При цьому змін в рівні експресії генів hBD-1 в залежності від дії
рек-ТФР-( не спостерігалось. За умов стимуляції клітин ліній А431 та
M-HeLa екзогенним ЕФР (10 мкг/мл) індукцію експресії мРНК hBD-2 було
відмічено, починаючи з 2 годин інкубації (Рис.6, б), але змін в рівні
експресії генів hBD-1 та HD-6 не спостерігали.

Рис. 6. Експресія гена hBD-2 (а) в клітинах А431/1522 за умов індукції
експресії рек-ТФР-( іонами Cd2+ через 1, 3, 6, 9, 12 год (треки 1-5,
відповідно), та (б) в клітинах А431 при інкубації з ЕФР (0, 2, 4, 6 год
— треки 1-4, відповідно). Треки 6 (а) та 5 (б) – маркери молекулярної
маси.

Таким чином, результати досліджень вперше продемонстрували, що
транскрипція гена hBD-2 в епітеліальних клітинах може бути індукована не
тільки внаслідок дії мікроорганізмів, але і факторів росту – ЕФР та
ТФР-(. Наші дані виявили існування спільних ланок в регуляції
ЕФР-залежної системи контролю росту та системи неспецифічного імунітету.

У зв’язку з цим паралельно з дослідженням експресії генів дефенсинів в
даній серії експериментів було визначено рівень фосфорилювання
ЕФР-рецептора та експресію генів, що його кодують, методом
напівкількісної ЗТ-ПЛР. В експерименті не було виявлено достовірного
відхилення рівня експресії гена ЕФРp в зразках клітин лінії А431, що
були інкубовані 6 годин в присутності ЕФР чи бактеріальних клітин, в
порівнянні з таким в контрольних клітинах. Таким чином, було
встановлено, що за умов індукції експресії гена hBD-2 рівень
транскрипції гена ЕФРp залишається на постійному рівні.

Наступною задачею було дослідити можливість взаємозв’язку між білковими
продуктами цих генів. Наші попередні дані вказували на те, що
антимікробний пептид здатний пригнічувати кіназну активність рецептора.
Тому було проведено експерименти по визначенню рівня аутофосфорилювання
ЕФРp в клітинах лінії А431, в яких після інкубації з ЕФР, мікробною
культурою чи ЛПС була індукована експресія hBD-2. Отримані дані (Рис.7)
показали, що: 1) грам-позитивні бактерії, ЛПС P.aeruginosa та ЕФР при
тому, що мають різні специфічні рецептори ( TLR-2, TLR-4 та ЕФРp,
відповідно), викликають швидку активацію аутофосфорилювання
рецептора

Рис.7. Аутофосфорилювання ЕФРр в клітинах А431, що інкубували з різними
чинниками на протязі 30 хв (а): – з ЕФР (трек 2), з ЛПС (трек 3), з
стерилізованою кип’ятінням культурою B.subtilis (трек 4) або 24 год (б):
з стерилізованою кип’ятінням культурою B.subtilis (трек2), ЛПС (треки
3,4), ЕФР (треки 5 та 6). Треки 1 та 7 – контролі. Для оцінки рівня
протеїнкіназної активності ЕФРр по закінченні 24 год інкубації клітини
додатково інкубували 30 хв з 0,5 мМ ЕФР (треки 1,2,3,6).

ЕФР, 2) при 24 годинній інкубації клітин з мікробними тілами, ЛПС чи ЕФР
знижується рівень аутофосфорилювання рецептора ЕФР, 3) тривале
культивування клітин А431 в присутності цих же чинників призводить до
накопичення одного й того ж білкового продукту, фосфорильованого по
тирозину, що має молекулярну масу 38-42 кДа. Ці дані, як ми вважаємо,
свідчать про те, що зниження кіназної активності рецептора ЕФР корелює з
продукцією hBD-2 і, що спільною ланкою функціонування ЕФРp та відповіді
клітини на мікробну інфекцію є білок з м.м. 38-42 кДа.

Отримані результати дозволили висунути власну гіпотезу про наявність
аутокринної петлі в регуляції активності рецептора ЕФР в епітеліальних
клітинах за участю hBD-2 (Рис.8). Згідно з цим припущенням, клітини
реагують на екзогенні стимули (фактори росту, бактерії, ЛПС) активацією
протеїн-кінази ЕФРр, наслідком якої є утворення відповідного сигнального
каскаду та прискорення проліферації клітини. В той же час мітогенний
стимул призводить до індукції експресії гена hBD-2, транскрипції
відповідної мРНК, утворення пептиду та його секреції епітеліальними
клітинами. Екзогенний hBD-2 зв’язується з рецептором ЕФР та інгібує його
протеїн-кіназну активність, тим самим блокуючи надмірну проліферативну
відповідь клітин.

Рис. 8. Гіпотетична схема аутокринної регуляції протеїнкіназної
активності ЕФРр за участю hBD-2.

Для дослідження властивостей ізольованого бета-дефенсину-2 людини, а
також з метою подальшого отримання моноклональних антитіл проти нього,
нами було клоновано відповідну кДНК, оптимізовано умови бактеріальної
експресії та виділено рекомбінантний білок. Для отримання рекомбінантної
молекули hBD-2 (рек-hBD-2) пептид експресували у вигляді химерного
білка, кон’югованого з глутатіон-S- трансферазою (GST), та оптимізували
умови його продукції.

Очистку злитого білку проводили згідно протоколу GST-fusion system
(центрифугування, афінна хроматографія на GST-сефарозі, протеоліз
тромбіном). Вихід рек-hBD-2 складав 200 мкг з 100 мл вихідної
бактеріальної культури.

Було встановлено, що очищений рек-hBD-2 є функціонально активним та
виявляє антимікробну активність в тесті Hultmark і пригнічуває
протеїн-кіназну активність ЕФРр в лізатах клітин А431. Ці дані остаточно
підтвердили висунуті раніше припущення про наявність у бета-дефенсину-2
людини якостей інгібітора кінази ЕФРр.

Розробка оригінальної схеми очищення рек-hBD-2 дозволила використати
його як антиген при імунізації тварин для отримання моноклональних
анти-hBD-2-антитіл (МКАТ) за стандартною гібридомною технологією. В
результаті було отримано та реклоновано 7 клонів гібридомних клітин, що
є позитивними в ELISA до hBD-2. Далі анти-hBD-2 МКАТ були напрацьовані
та очищені. Їх специфічність досліджено методами Вестерн-блот аналізу та
імуногістохімії. Встановлено, що анти-hBD-2 МКАТ специфічно впізнають
антиген (рек-hBD-2) та нативний hBD-2 на зрізах пухлин вульви та шийки
матки людини і можуть бути використані для аналізу експресії hBD-2 в
пухлинах різної локалізації.

Дослідження, проведені in vitro, продемонстрували, що в злоякісних
клітинах, що мають походження з пухлин шийки матки та вульви людини,
експресуються гени дефенсинів, причому експресія hBD-2 індукується у
відповідь на дію факторів росту та може впливати на активність кінази
рецептора ЕФР. З чисельних даних літератури відомо, що пухлини вульви та
шийки матки людини характеризуються гіперекспресією мРНК ЕФРр та ЕФР.
Цей показник свідчить про поганий прогноз захворювання і може бути
наслідком експресії генів папіломатозних вірусів в пухлинних клітинах.
Тому наступною задачею даної роботи було проведення експериментів по
визначенню рівня експресії генів дефенсинів в злоякісних новоутвореннях
шийки матки та вульви людини у порівнянні з нормальною тканиною того ж
гістогенезу та їх можливу асоціацію з папіломовірусною інфекцією та
гіперекспресією мРНК ЕФРр.

В даній серії експериментів досліджено експресію генів дефенсинів hBD-1,
hBD-2 та HD-6 на клінічному матеріалі, отриманому із зразків 25 пухлин
вульви та 15 пухлин шийки матки (Табл. 4, 5). Контролем була
макроскопічно незмінена тканина тих же паціентів, що видалялася під час
операції, згідно правил проведення операцій такого типу. У всіх зразках
пухлин і лише у деяких зразках нормальних тканин отримана позитивна
відповідь при проведенні ПЛР на інфікованість папіломавірусом (Табл. 4,
5).

В усіх досліджуваних зразках пухлин вульви та шийки матки виявлено
високий рівень експресії гена hBD-2, при цьому в жодному з досліджених
зразків макроскопічно незміненої тканини експресію гена hBD-2 не було
зареєстровано. Поряд з цим, у 70% випадків в зразках пухлинної тканини
рівень експресії гена hBD-1 був вищим у порівнянні з таким у зразках
нетрансформованих тканин.

Достовірних закономірностей відносно рівня експресії гена НD-6 в
пухлинній тканині в порівнянні з макроскопічно незміненою не отримано.
Крім того, аналіз макроскопічно незмінених і трансформованих тканин
вульви та шийки матки людини дозволив встановити, що в клітинах усіх
досліджених зразків пухлин та в 30 % зразків умовно нормального епітелію
вульви та шийки матки людини присутня ДНК папіломавірусу (Табл. 4, 5).
Отримані нами дані виявили гіперекспресію мРНК ЕФРр в пухлинах вульви та
шийки матки у порівнянні з відповідними зразками умовно нормальних
тканин.

Таблиця 4

Експресія генів hBD-1, hBD-2, HD-6 та наявність ДНК HPV в зразках пухлин
(П) та умовно-нормального епітелію (Н) вульви людини

Пацієнт hBD-1 hBD-2 HD-6 HPV ЕФРр ААТ

№ ВІК TNM Н П Н П Н П Н П Н П

1 62 T2N2M0 + ++ — ++ + ++ — + * * +++

2 58 T3N1M1 + +++ — ++ ++ ++ — + * * +++

3 52 T2N0M0 ++ ++ — +++ ++ +++ — + * * ++

4 50 T2N0M0 + + — ++ ++ + — + * * +

5 62 T3N1M0 ++ +++ — ++ ++ ++ — + * * ++

6 67 T3N1M0 + +++ — +++ ++ +++ * * + ++ +

7 62 T2NхM0 ++ ++ — +++ +++ +++ — + * * +

8 52 T3N1M1 ++ +++ — + + +++ — + * * *

9 76 T3N2M0 ++ +++ — ++ ++ ++ * * * * +++

10 60 T3N0M0 ++ +++ — ++ + + — + * * +++

11 64 T2N0M0 + +++ — + ++ +++ + + * * ++

12 69 T2NхM0 ++ ++ — +++ ++ ++ — + + +++ +

13 61 T3N0M0 + +++ — ++ ++ + — + ++ +++ +++

14 56 T2N0M0 + ++ — +++ ++ ++ * * + ++ ++

15 71 T3N2M0 ++ +++ — +++ ++ ++ + + * * *

16 74 T2NхMх + + — + + ++ * * * * *

17 67 T3N1M0 ++ +++ — ++ ++ +++ — + ++ +++ *

18 65 T3N2M0 ++ ++ — ++ + +++ — + * * *

19 58 T2NхMх + +++ — +++ ++ ++ * * * * *

20 62 T3N0M0 + ++ — ++ + ++ + + * * *

21 70 T3N1M0 ++ ++ — + ++ + * * * * *

22 56 T2N0M0 + + — ++ ++ ++ * * * * *

23 61 T3N0M0 ++ ++ — + + +++ — + * * *

24 69 T2NхM0 + +++ — +++ + ++ * * * * *

25 65 T3N2M0 ++ +++ — +++ ++ ++ — + * * *

Таблиця 5

Експресія генів hBD-1, hBD-2, HD-6 та наявність ДНК HPV в зразках пухлин
(П) та умовно-нормального епітелію (Н) шийки матки людини

Пацієнт hBD-1 hBD-2 HD-6 HPV ЕФРр ААТ

№ ВІК TNM Н П Н П Н П Н П Н П

1 52 T1N1M0 ++ ++ — + ++ ++ * * * * —

2 83 T2N0M0 + ++ — + ++ ++ * * ++ ++ +++

3 61 T2N0M0 ++ +++ — +++ +++ +++ — + * * ++

4 57 T1N0M0 + +++ — ++ ++ +++ — + + +++ +++

5 35 T3N1M0 ++ +++ — +++ ++ + + + + +++ *

6 37 T1NхM0 ++ ++ — ++ ++ +++ — + * * *

7 48 T1N0M0 + ++ — ++ ++ ++ — + * * *

8 49 T1N0M0 ++ +++ — ++ ++ ++ — + + ++ *

9 65 T3N1M0 + +++ — ++ +++ ++ + + * * ++

10 37 T1NхM0 ++ ++ — + + ++ + + * * *

11 43 T1N0M0 + +++ — +++ ++ ++ * * ++ +++ +

12 79 T2N1M0 + ++ — ++ ++ +++ — + * * *

13 56 T1N0M0 + + — ++ + ++ — + * * *

14 40 T1N0M0 ++ +++ — + +++ +++ + + * * *

15 69 T1N0M0 +++ +++ — ++ ++ ++ — + * * *

Примітка: /+/ — низький рівень експресії мРНК чи вмісту анти- hBD-2
антитіл; /++/ — середній рівень експресії мРНК чи вмісту анти- hBD-2
антитіл; /+++/ — високий рівень експресії мРНК чи вмісту анти- hBD-2
антитіл; /-/ — ДНК HPV не виявлено; /+/ — ДНК HPV виявлено;/*/ — маркер
не досліджувався, ААТ – анти- hBD-2 антитіла в сироватці крові хворих.

Таким чином, узагальнюючи отримані дані, можна зробити висновок, що
злоякісно трансформований епітелій вульви та шийки матки людини, на
відміну від нормального епітелію, характеризується підвищеними рівнями
експресії генів hBD-1 та ЕФРр та наявністю експресії гена hBD-2, яка
жорстко асоційованою з пухлинними новоутвореннями.

Імуногістохімічне дослідження експресії hBD-2 з використанням
моноклональних анти-hBD-2-антитіл доповнило дані щодо гіперекспресії
мРНК hBD-2 в пухлинах шийки матки та вульви людини та дозволило
встановити, що цей пептид інтенсивно експресується в цитоплазмі
пухлинних клітин (Рис.9).

Таким чином, отримані дані продемонстрували, що злоякісні новоутворення
вульви та шийки матки людини характеризуються гіперекспресією
бета-дефенсину-2 як на рівні мРНК, так і на рівні білку. В той же час з
даних літератури відомо, що hBD-2 є біомолекулою з високим рівнем
імуногенності та має ад’ювантну активність. У зв’язку з цим було
висунуто припущення, що підвищена експресія hBD-2 в пухлинах шийки матки
та вульви людини може мати наслідком появу в сироватці хворих
анти-hBD-2-аутоантитіл. Для перевірки цієї гіпотези рівень
анти-hBD-2-антитіл в сироватці онкологічних хворих було досліджено
імуноферментним методом (ELISA) з використанням рек-hBD-2 в якості
антигена (Табл. 4, 5). Отримані дані доз-

Рис.9. Імуногістохімічне дослідження експресії hBD-2 з використанням
анти-hBD-2-МКАТ в пухлинах шийки матки (б) та вульви людини (г) в
порівнянні з умовно-нормальними тканинами (а, в — відповідно).

волили встановити, що відносний рівень анти-hBD-2-аутоантитіл в
сироватці крові хворих на рак шийки матки та вульви є підвищеним у
порівнянні з таким у здорових донорів.

Узагальнюючи наведені дані, можна зробити висновок про наявність
гіперекспресії бета-дефенсину-2 в пухлинних клітинах шийки матки та
вульви людини. Беручи до уваги антипроліферативну активність hBD-2 як
інгібітора кінази рецептора ЕФР, можна висунути припущення про
потенційну пухлино-супресорну функцію hBD-2 в епітеліальних клітинах
пухлин шийки матки та вульви людини. Наявність підвищеної експресії
пептиду в пухлинах вульви може зумовлювати появу анти- hBD-2-аутоантитіл
в сироватці крові онкологічних хворих.

ВИСНОВКИ

Робота присвячена дослідженню ролі дефенсинів в регуляції активності
рецептора ЕФР в пухлинних клітинах людини. Отримані дані дозволили
встановити, що бета-дефенсин-2 людини є аутокринним ефектором
протеїн-кіназної активності ЕФРр, і, відповідно, може впливати на
проліферацію малігнізованих та нормальних епітеліальних клітин людини.

Створено експериментальні клітинні сублінії А431/1522 та M-HeLa/1522, що
контрольовано продукують функціонально активний рекомбінантний ТФР-( в
зрілій та мембранозв’язаній недопроцесованій формах.

Показано, що тривала аутокринна стимуляція клітин сублінії А431/1522
рекомбінантним ТФР-( призводить до зниження рівней фосфорилювання ЕФРр
та проліферації клітин та секреції пептиду з властивостями інгібітора
кінази ЕФРр.

Встановлено ідентичність інгібітора кінази ЕФРр з бета-дефенсином-2
людини (hBD-2).

Встановлено, що hBD-2 поряд з широким спектром антимікробної,
цитолітичної і гемолітичної активності має властивості інгібітора
низки тирозин- та серин/треонін-кіназ ( ЕФРр, ??Syk, Lyn та PKC( ).

Показано, що в клітинах А431 та M-HeLa експресія гена hBD-2 може бути
індукована дією ЕФР, ТФР-(, грам-позитивних бактерій B.subtilis та
ліпополісахаридом з P.aeruginosa.

Встановлено, що за умов експресії hBD-2 рівень експресії мРНК ЕФРр не
змінюється, проте знижується рівень протеїн-кіназної активності ЕФРр.

Доведено, що клітини злоякісних новоутворень вульви та шийки матки
людини на відміну від умовно-нормальних клітин характеризуються
підвищеним рівнем експресії генів hBD-1 і ЕФРр та наявністю експресії
hBD-2 на рівні мРНК та білка.

8. Методами генної інженерії отримано та охарактеризовано
біологічно-активний рекомбінантний бета-дефенсин-2 людини і оптимізовано
умови його продукції .

9. Отримано та охарактеризовано анти-hBD-2-моноклональні антитіла, що
специфічно розпізнають рекомбінантний та нативний hBD-2 в Вестерн-блот
аналізі та на парафінових зрізах пухлин.

10. Запропоновано схему аутокринної регуляції ЕФРр за участю hBD-2.

ПЕРЕЛІК РОБІТ, ОПУБЛІКОВАНИХ ЗА ТЕМОЮ ДИСЕРТАЦІЇ

Погрібний П.В. Ендогенні пептидні антибіотики як фактори імунітету
тварин // Біополімери і клітина. – 1998. – Т.14, №6. – С.512-518.

Phylchenkov A., Slukvin I., Pogrebnoy P.V., Kudryavets Yu., Didkovskaya
L., Kulik G., Chernishov V., Bykorez A. Application of flow cytometry
with anti-EGF-receptor antibody and 125I-EGF binding assay for detection
of EGF-receptors in certain human tumor cell lines// Эксперим.
онкология.-1992.-Т.14, №1.- С.45-49. (Автором проведено дослідження in
vitro з використанням анти-ЕФРр антитіл і 125 І-ЕФР, підготовлено
статтю до друку).

Кулик Г.А., Кононенко Л.И., Погребной П.В., Быкорез А.И. Влияние
12-0-тетрадеканоилфорбол-13-ацетата и аденозин-3’-фосфата на димеризацию
рецепторов эпидермального фактора роста и ассоциацию димеров с
цитоскелетом клеток линии А431 // Эксперим. онкология. – 1992. – Т.14, №
6. – С.27-32. (Автором проведено дослідження in vitro та ковалентне
мічення ЕФРр, сформульовано висновки роботи).

Погребной П.В., Гарманчук Л.В., Серов С.М., Кленчин В.А., Лукьянов А.В.,
Тарнавский Д., Маркеева Н.В., Быкорез А.И. Экспрессия гена ТФР альфа,
перенесенного рекомбинантным ретровирусным вектором в клетки А431 //
Молекулярная биология. – 1993. – Т.27, №4. – С.833-838. (Автором
проведено трансфекцію клітин А431 ретровірусним вектором та
проаналізовано отримані клони, підготовлено статтю до друку).

Погребной П.В., Гарманчук Л.В., Лукьянов А.В., Тарнавский Д., Быкорез
А.И. Трансформирующий фактор роста типа альфа стимулирует экспрессию
белка-аналога рецептора эпидермального фактора роста // Эксперим.
онкология. – 1993. – Т.15, №5. – С.30-32. (Автором сформульовано задачі
дослідження, проведено дослідження in vitro, підготовлено статтю до
друку).

Погребной П.В., Гарманчук Л.В., Лукьянов А.В., Маркеева Н.В., Белоус
Н.И., Быкорез А.И. Уменьшение экспрессии рецептора эпидермального
фактора роста в клетках сублиний А431/1522-4 со встроенным геном
трансформирующего фактора роста типа альфа// Эксперим. онкология. –
1994. – Т.16, №1. – С.37-40. (Автором сформульовано задачі дослідження,
проведено дослідження in vitro, проаналізовано результати, підготовлено
статтю до друку).

Kulik G.A., Kartel A.A., Kononenko L.I., Tarnavski D.V., Pogrebnoy P.V.,
Bykorez A.I. Transforming growth factor-? and epidermal growth factor
stimulate oligomerization and autophosphorylation of epidermal growth
factor receptor in A431 living cells// Эксперим. онкология. – 1994. –
Т.16, №1. – С.33-36. (Автором проведено дослідження in vitro,
сформульовано задачі дослідження, проведено аналіз даних літератури,
підготовлено статтю до друку).

Маркеева Н.В., Гарманчук Л.В., Погребной П.В. Аутофосфорилирование
рецептора эпидермального фактора роста в клетках линии А431 и сублинии
А431/1522-4 при действии ЭФР/ТФР-?// Эксперим. онкология. – 1994. –
Т.16, №4-6. – С.453-457. (Автором проведено дослідження in vitro з
використанням ізотопу фосфору, підготовлено статтю до друку).

Глушков А.Н., Аносова Т.П., Аносов М.П., Гарманчук Л.В., Погребной П.В.
Выявление антител против рецептора эпидермального фактора роста в
сыворотке крови онкологических больных // Эксперим. онкология. – 1996. –
Т.18, №1. – С.81-83. (Автором проведено аналіз сироваток крові хворих,
підготовлено статтю до друку).

Соловьян В.Т., Андреев И.О., Колотова Е.Ю., Погребной П.В., Тарнавский
Д.В. Упорядоченная деградация ядерной ДНК как специфическая геномная
реакция, сопровождающая апоптоз, ответ на стресс и дифференцировку //
Биополимеры и клетка. – 1996. – Т.12,№ 3. – С.67-76. (Автором проведено
дослідження in vitro та молекулярно-біологічні дослідження ДНК клітин,
підготовлено статтю до друку).

Погребной П.В., Гарманчук Л.В., Маркеева Н.В., Протас А.Ф., Быкорез А.И.
Особенности влияния мелиттина и его триптолитического фрагмента на
активность протеинкиназы С // Биополимеры и клетка. – 1996. – Т.12, № 3.
– С.41-46. (Автором проведено дослідження активності протеїнкінази С та
аналіз отриманих триптолітичних фрагментів, підготовлено статтю до
друку).

Sololov’yan V.T., Andreev I.O., Kolotova T.Yu., Pogribniy P.V.,
Tarnavsky D.T., Kunach V.A. The cleavage of nuclear DNA into high
molecular weight DNA fragments occurs not only during apoptosis but also
accompanies changes in functional activity of the nonapoptotic cells
// Exp.Cell Res. – 1997. – V.235. – С.130-137.(Автором проведено
дослідження in vitro та молекулярно-біологічні дослідження ДНК клітин,
підготовлено статтю до друку).

Погребной П.В., Гарманчук Л.В., Маркеева Н.В., Хобта А.И., Серов С.М.,
Быкорез А.И. Гиперэкспрессия трансформирующего фактора роста альфа
клетками M-HeLa/1522 // Эксперим. онкология. – 1997. – Т.19, №1. –
С.50-55. (Автором проведено трансфекцію клітин M-HeLa ретровірусним
вектором та проаналізовано отримані клони, підготовлено статтю до
друку).

Погребной П.В., Хобта А.И., Гарманчук Л.В., Маркеева Н.В. Ингибирование
киназной активности рецептора ЭФР гидрофобным пептидом, секретируемым
клетками А431/1522 // Эксперим. онкология. – 1997. – Т.19, № 4. –
С.296-299. (Автором проведено дослідження in vitro кіназної активності
ЕФРр, підготовлено статтю до друку).

Гарманчук Л.В., Хобта А.И., Маркеева Н.В., Погребной П.В., Быкорез А.И.
Изменение соотношений молекулярных форм трансформирующего фактора роста
альфа и мРНК рецептора ЭФР при гепатоканцерогенезе, индуцированном
N-нитрозодиэтиламином у крыс // Эксперим. онкология. – 1998. – Т.20, №1.
– С.29-32. (Автором проведено біохімічне дослідження молекулярних форм
ЕФРр, проаналізовано результати, підготовлено статтю до друку).

Pogrebnoy P.V., Hobta A.I., Soldatkina M.A., Garmanchouk L.V., Markeeva
N.V., Eremenko T. A protein kinase inhibitor from A431 subline
overexpressing TGFa possesses antimicrobial activity // New
Microbiologica. – 1998. – V.21, №3. – Р.269-273. (Автором проведено
дослідження in vitro та мікробіологічні дослідження, підготовлено статтю
до друку).

Hobta A.I., Pogrebnoy P.V. Mammalian peptide antibiotics as regulatory
and anticancer agents // Exp. Oncol. – 1998. – V.20, № 3-4. – P.170-179.
(Автором проведено збір та аналіз даних літератури, підготовлено огляд
до друку).

Погребной П.В., Кухаренко А.П., Тихонкова И.А., Пальчевский С.С.,
Савинская Л.А., Погребная А.П., Валевка Т.И., Маркеева Н.В., Солдаткина
М.А., Мацука Г.Х., Гут И.Т., Филоненко В.В. Получение и характеристика
моноклональних антител против р70S6-киназы ?// Эксперим. онкология. –
1999. – Т.21, №3-4. – с.232-238. (Автором проведено вдосконалення
методики отримання гібридомних клітин, отримано
анти-р70S6К-моноклональні антитіла, підготовлено статтю до друку).

Лісовський І.Л., Хобта А.І., Солдаткіна М.А., Литвин Д.І., Маркеєва
Н.В., Сидорик Л.Л., Погрібний П.В. Експресія гена дефенсину-6 (HD-6) у
лініях пухлинних клітин людини// Биополимеры и клетка.- 2000.- Т.16,
№6.- С.525-529. (Автором проведено дослідження in vitro та
молекулярно-біологічні дослідження, проаналізовано отримані дані).

Lisovskiy I.L., Soldatkina M.A., Lytvyn D.I., Markeeva N.V., Turchak
O.V., Nespryad’ko S.V., Vinnitskaya A.B., Pogrebnoy P.V. Expression of
defensins genes in А431 and М-Hela cell lines and in tumors of human
vulval and cervical carcinoma // Эксперим. онкология. – 2001. –Т.23,
№2. – С.119-122. (Автором проведено дослідження in vitro та
молекулярно-біологічні дослідження, проаналізовано отримані дані,
підготовлено статтю до друку).

Lisovskiy I.L., Soldatkina M.A., Lytvyn D.I., Markeeva N.V., Turchak
O.V., Nespryad’ko S.V., Vinnitskaya A.B., Nosach L.N., Povnitsa O.U.,
Pogrebnoy P.V. Pattern of expression of beta-definsin-2 (hBD-2) and EGFR
mRNA in malignant cells of human cervix and vulvae // Эксперим.
онкология. – 2001. – Т.23, №4. – С. 248-252. (Автором проведено забір
клінічних зразків та молекулярно-біологічні дослідження, проаналізовано
отримані дані, підготовлено статтю до друку).

Hobta A.I., Lisovskiy I.L., Mikhalap S., Kolybo D., Romanyuk S.,
Soldatkina М., Markeeva N., Garmanchouk L., Sidorenko S., Pogrebnoy P..
Epidermoid Carcinoma derived Antimicrobial Peptide (ECAP) inhibits
phosphorylation by protein Kinases in vitro// Cell Biochem Func. – 2001.
– № 19. – Р. 291-298. (Автором проведено дослідження in vitro та
імунопреципітацію кіназ, проаналізовано отримані дані, підготовлено
статтю до друку).

Pogribnoy P.V., Lisovskiy I.L., Markeeva N.V., Shnitsar V.M., Zinchenko
I.I., Soldatkina M.A.. Produсtion of recombinant of hBD-2 – human
antimicrobial peptide expressed in cervical and vulval cancer //
Эксперим. онкология. – 2003. – Т.25, №1. – С. 36-39. (Автором проведено
клонування та характеристика рекомбінантного пептиду, підготовлено
статтю до друку).

Shnitsar V.M., Soldatkina M.A., Zinchenko I.I., Markeeva N.V., Rodnin
N.V., Nespyadko S.V., Turchak O.V., Vinnitskaya A.B., Pogrebnoy P.V.
Autoantibodies against human beta-defensin-2 in the blood serum of
patients with vulval and cervical cancer // Эксперим. онкология. – 2003.
– Т.25, №3. – С. 155-157. (Автором проведено дослідження сироваток крові
хворих методом ELISA, проаналізовано отримані дані).

Лісовський І.Л., Солдаткіна М.О., Литвин Д.І., Шніцар В.М., Маркеєва
Н.В., Сєров С.М., Погрібний П.В. Гіперекспресія трансформуючого фактору
росту ( та механізми контролю росту клітин лінії А431/1522 // “Шляхи та
перспективи розвитку експериментальної онкології в Україні”, під. ред.
Чехуна В.Ф. // “ДІА”, Київ, 2001. – С. 70-77.

Tarnavski D.V., Garmanchuk L.V., Markeeva N.V., Pogrebnyi P.V..
Expression of TGF-? gene transferred into M-Hela, A431 human cells//
Тези The Protein Society, First European Symposium, Switzerland, Davos.
– 1995. – Р. 104.

Hobta A.I., Garmanchouk L.V., Markeeva N.V., Pogrebnyi P.V. The novel
antimicrobial peptide production in culture of human carcinoma A431
cells transfected with TGFa gene// Тези 8th European Congress on
Biotechnology, Hungary, Budapest. — 1997. – Р. 96-97.

Hobta A., Lisovskiy I., Soldatkina M., Markeeva N., Pogribnoy P.
Inhibition of the protein kinases by ECAP// Тези 26th Meeting of the
Federation of European Biochemical Societies, France, Nice. – 1999. – Р.
256.

Lisovsky I., Hobta A., Soldatkina M., Pogrebnoy P.V. Detection of
expression of beta defensin gene in human tumor cells// Тези П съезда
онкологов стран СНГ, Украина, Киев. — 2000. – С. 145.

Lisovsky I., Hobta A., Soldatkina M., Garmanchuk L., Lytvyn D.,
Pogribnyi P. Induction of cationic antimicrobial peptides in cultured
cells exposed to ligands of EGF receptor// Тези 3th Parnas Conference
“Mechanisms of cellular signal transduction and communication”,
Ukraine, Lviv. — 2000. – Р. 82.

Lisovskiy I., Hobta A., Soldatkina M., Garmanchouk L., Markeeva N.,
Lytvyn D., Pogribnyi P. Detection of mRNA for beta-defensin 2 in human
cell lines of epithelial origin// Тези 18th International Congress of
Biochemistry and Molecular Biology, UK, Birmingham. — 2000. – Р. 162.

Lisovskiy I.L., Soldatkina M.A., Lytvyn D.I., Markeeva N.V., Nosach
L.N., Povnitsa O.U., Pogrebnoy P.V. Expression pattern of defensin genes
in cervical and vulval cancer cells// Тези Intern.Sympos.Intracellular
Signalling in Plant and Animal Systems, Ukraine, Kyiv.- 2001. — Р.76.

Лісовський І.Л., Солдаткіна М.О., Погрібний П.В. Експресія генів
дефенсинів в пухлинах генітальної системи людини//Тези Х з’їзд онкологів
України, Україна, Крим. — 2001. — С. 45.

Pogrebnoy P.V., Markeeva N.V., Lisovskii I.L., Soldatkina M.A. Defensin
and EGFR mRNA expression in transformed human cells// Тези 4th Parnas
Conference “Molecular mechanisms of cell activation: biological signals
and their target enzymes”, Poland, Wroclaw. — 2002. – Р. 70.

Soldatkina M.A., Markeeva N.V., Lisovskii I.L., Podrebnoy P.V. Defensin
and EGFR expression in human cervical, vulval and gastric tumors// Тези
4th Parnas Conference “Molecular mechanisms of cell activation:
biological target enzymes”. Poland, Wroclaw. — 2002. – Р. 55.

АНОТАЦІЯ

Погрібний П.В. Дефенсини та регуляція активності рецептору
епідермального фактора росту в пухлинних клітинах людини. – Рукопис.

Дисертація на здобуття наукового ступеня доктора біологічних наук за
спеціальністю 14.01.07 – онкологія. Інститут експериментальної
патології, онкології і радіобіології ім. Р.Є.Кавецького НАН України,
Київ, 2004.

Дисертація присвячена встановленню ролі дефенсинів в аутокринній
регуляції активності рецептора епідермального фактора росту (ЕФРр) в
пухлинних клітинах людини.

Дослідження проведено на трансформованих клітинах людини ліній A431 та
M-HeLa і субліній A431/1522 та M-HeLa 1522, що контрольовано
гіперекспресують TФР-(, та зразках хірургічно видалених пухлин вульви та
шийки матки 25 та 15 пацієнтів відповідно.

В експериментах in vitro встановлено, що при дії EФР/TФР-( на
трансформовані епітеліальні клітини індукується експресія
бета-дефенсину-2 людини (hBD-2) на рівні мРНК та білка. Виявлено, що
hBD-2 має широкий спектр біологічної активності, а саме антимікробну,
протигрибкову, цитотоксичну, здатний концентраційно-залежним шляхом
впливати на проліферацію культивованих клітин та інгібувати тирозин- та
серин/треонин протеїн-кіназну активність EФРр, Syk, Lyn та PKC(.
Отримані результати дали можливість запропонувати гіпотетичну схему,
згідно якої hBD-2 може приймати участь в регуляції активності ЕФРр.

Отримано рекомбінантний hBD-2 та анти-hBD-2 моноклональні антитіла, які
було використано при проведенні досліджень експресії hBD-2 в пухлинах
шийки матки та вульви людини. При дослідженні хірургічно видалених
зразків пухлин людини виявлено, що експресія hBD-2 на рівнях мРНК та
білка жорстко асоційована з пухлинними клітинами, а також з
гіперекспресією ЕФРр та наявністю інфекції папіломатозними вірусами.

Ключові слова: бета-дефенсини, рецептор епідермального фактору росту,
експресія, рак вульви, рак шийки матки.

АННОТАЦИЯ

Погребной П.В. Дефенсины и регуляция активности рецептора эпидермального
фактора роста в опухолевых клетках человека.

Диссертация на соискание ученой степени доктора биологических наук по
специальности 14.01.07 – онкология. Институт экспериментальной
патологии, онкологии и радиобиологии им. Р.Е.Кавецкого НАН Украины,
Киев, 2004.

Диссертация посвящена установлению роли дефенсинов в аутокринной
регуляции активности рецептора эпидермального фактора роста (ЭФРр) в
опухолевых клетках человека.

Исследование проведено на трансформированных клетках человека линий A431
и M-HeLa и сублиний A431/1522 и M-HeLa/1522, которые контролированно
гиперэкспресируют TФР-(, и образцах хирургически удаленных опухолей
вульвы и шейки матки 25 та 15 пациентов соответственно.

Методами генной инженерии созданы экспериментальные клеточные сублинии
А431/1522 и M-HeLa/1522, которые контролиролируемо продуцируют
функционально активный рекомбинантный ТФР-( в зрелой и
мембранносвязанной недопроцессированной формах. Показано, що
продолжительная аутокринная стимуляция клеток сублинии А431/1522
рекомбинантным ТФР-( приводит к снижению уровня фосфорилирования
рецептора ЭФР и пролиферации клеток и секреции пептида со свойствами
ингибитора киназы рецептора ЭФР. Установлена идентичность ингибитора
киназы ЭФРр с бета-дефенсином-2 человека (hBD-2).

В экспериментах in vitro установлено, что в трансформированных
эпителиальных клетках, инкубированных с ЭФР или TФР-(, экспрессия hBD-2
индуцируется на уровне мРНК и белка. Показано, что hBD-2 имеет широкий
спектр биологической активности. Бета-дефенсин-2 человека проявляет
антимикробную активность против ряда грам-положительных и
грам-отрицательных бактерий в микромолярном диапазоне концентраций и
фунгистатическое действие в концентрациях 100 — 200 мкМ. Установлено,
что hBD-2 является ингибитором активности киназы ЭФРр и ряда клеточных
протеинкиназ (PKC???Syk і Lyn), причем действие пептида на киназы
характеризуется низкой селективностью и проявляется в диапазоне
концентраций 10-7-10-6 М. В концентрациях ниже 5 х 10-8 М hBD-2
стимулирует пролиферацию клеток in vitro, в концентрации 6-10-8 -5 х
10-7 М — угнетает синтез ДНК, а в более высоких концентрациях проявляет
цитотоксическое действие и гемолитическую активность.

На основе полученных результатов предложена гипотетическая схема участия
hBD-2 в регуляции активности ЭФРр, согласно которой клетки реагируют на
экзогенные стимулы (факторы роста, бактерии, ЛПС) активацией
протеин-киназы ЭФРр, вследствие чего активируется соответствующий
сигнальный каскад и стимулируется пролиферация клеток. В то же время
митогенный стимул индуцирует экспрессию гена hBD-2, транскрипцию
соответствующей мРНК, синтез пептида и его секрецию эпителиальными
клетками. Экзогенный hBD-2 связывается с рецептором ЭФР и ингибирует его
протеин-киназную активность, тем самым блокируя чрезмерный
пролиферативный ответ клеток.

Клонированием кДНК гена бета-дефенсина-2 в бактериальной культуре в
составе рекомбинантной плазмиды в виде химерного белка получен
рекомбинантный hBD-2. После очистки рек-hBD-2 было установлено, что по
функциональной активности он не отличается от нативного пептида. .

Рек-hBD-2 был использован в качестве антигена для получения
анти-hBD-2-моноклональных антител, которые применены при проведении
иммуногистохимических исследований экспрессии hBD-2 в опухолях шейки
матки и вульвы человека. Исследование хирургически удаленных образцов
опухолей человека продемонстрировало, что экспрессия hBD-2 на уровне
мРНК и белка жестко ассоциирована с опухолевыми клетками, а также с
гиперэкспрессией ЭФРр и наличием инфекции папилломатозными вирусами.

Ключевые слова: бета-дефенсины, рецептор эпидермального фактора роста,
экспрессия, рак вульвы, рак шейки матки.

SUMMARY

Pogribniy P.V. Defensins and Regulation of the Activity of Epidermal
Growth Factor Receptor in Human Tumor Cells.

Thesis for the degree of Doctor of Biological sciences by speciality
14.01.07 – oncology.- R.E.Kavetsky Institute of Experimental Pathology,
Oncology and Radiobiology of NAS of Ukraine, Kyiv, 2004.

The dissertation was aimed on the estimation of the role of defensins in
autocrine regulation of epidermal growth factor receptor (EGFr) activity
in human tumor cells.

The research was performed on transformed human cell of A431 and M-HeLa
lines, sublines A431/1522 and M-HeLa 1522, hyperexpressing TGF-(, and
samples of surgically resected human vulval and cervical tumors from 25
and 15 patients respectively.

It has been shown in vitro that in transformed epithelial cells the
treatment with EGF/TGF-( results in the induction of expression of
human-beta-defesin-2 (hBD-2) both on mRNA and protein levels. hBD-2 was
shown to possess broad range of biological activities, in particular,
antimicrobial, antifungal, cytotoxic ones, able to affect proliferation
rate of cultured epithelial cells in a concentration-dependent fashion
and inhibit protein kinase activity of EGFr, Syk, Lyn, and PKC(. On the
base of obtained results, the hypothetic scheme for hBD-2 involvement in
regulation of EGFr activity is proposed.

The recombinant hBD-2 and anti-hBD-2 monoclonal antibodies were
generated and used in the research of hBD-2 expression in human vulval
and cervical tumors. The study of the samples of surgically resected
human vulval and cervical tumors has demonstrated that expression of
hBD-2 both on mRNA and protein levels is strongly associated with tumor
phenotype, and also with hyperexpression of EGFr and infection with
papillomatosis viruses.

Key Words: beta-defensins, epidermal growth factor receptor, expression,
vulval tumor, cervical tumor.

Похожие записи