НАЦІОНАЛЬНА АКАДЕМІЯ НАУК УКРАЇНИ

ІНСТИТУТ МОЛЕКУЛЯРНОЇ БІОЛОГІЇ І ГЕНЕТИКИ

БОРИСЕНКО Леонід Григорович

УДК 577.21: 578.26

Розподіл і експресія ендогенних ретровірусів у геномі птахів

03.00.03 – молекулярна біологія

Автореферат

дисертації на здобуття наукового ступеня

кандидата біологічних наук

Київ — 2004

Дисертацією є рукопис.

Роботу виконано у відділі молекулярної онкогенетики Інституту
молекулярної біології і генетики НАН України (м. Київ), лабораторії
молекулярної еволюції Зоологічної станції «Антон Дорн» (м. Неаполь,
Італія), відділі молекулярної генетики і біології розвитку Національного
дослідницького центру (м. Вільжуіф, Франція).

Науковий керівник: доктор біологічних наук, професор,

член-кореспондент НАН України

Риндич Алла Володимирівна,

Інститут молекулярної біології і генетики НАН України,

завідувач відділу молекулярної онкогенетики.

Офіційні опоненти: доктор біологічних наук,

старший науковий співробітник

Швед Анатолій Давидович,

Інститут молекулярної біології і генетики НАН України,

завідувач відділу молекулярної вірусології;

доктор біологічних наук,

старший науковий співробітник

Кудрявець Юрій Йосипович,

Інститут експериментальної патології, онкології та

радіобіології імені Р.Є. Кавецького,

завідувач відділу експериментальних клітинних систем.

Провідна установа: Інститут мікробіології та
вірусології імені Д.К. Заболот-

ного НАН України, м. Київ.

Захист дисертації відбудеться “26” жовтня 2004 р. о 10 годині на
засіданні спеціалізованої вченої ради Д26.237.01 Інституту молекулярної
біології і генетики НАН України за адресою: 03143, м.Київ, вул.
Заболотного, 150.

З дисертацією можна ознайомитись у бібліотеці Інституту молекулярної
біології і генетики НАН України за адресою: 03143, м.Київ, вул.
Заболотного, 150.

Автореферат розіслано 21 вересня 2004 року.

Вчений секретар

спеціалізованої вченої ради

кандидат біологічних наук
О.В. Підпала

ЗАГАЛЬНА ХАРАКТЕРИСТИКА РОБОТИ

Актуальність теми. Підвищений інтерес до вивчення ретровірусів
пов’язаний з їх значенням як природних агентів онкогенезу. Інтеграція є
важливим етапом життєвого циклу всіх ретровірусів, адже їхні патогенні
ефекти пов’язані саме з інтеграцією. Відомо, що мутації, які запобігають
інтеграції, унеможливлюють процес реплікації ретровірусів. З практичної
точки зору дослідження інтеграції важливе для генної терапії, де
ретровіруси використовують як вектори. Все це вказує на актуальність
вивчення процесу інтеграції.

Питання про специфічність інтеграції ретровірусів виникло ще з часу
висунення провірусної гіпотези. Секвенування та рестрикційний аналіз
ділянок ДНК, які безпосередньо фланкують ретровіруси, не виявило
будь-якої специфічності цього процесу. І лише при застосуванні
композиційного підходу до вивчення інтеграції ретровірусів, вдалося
встановити, що вона є компартменталізованою (тобто, відбувається лише в
певні ділянки геному) та ізопікнічною (ГЦ-склад ділянки геному, де
відбулась інтеграція, близький до ГЦ-складу геному ретровірусу)
(Rynditch et al., 1998). Композиційний підхід також дав змогу
встановити, що геноми теплокровних хребетних складаються із довгих,
гомогенних за ГЦ-складом сегментів ДНК, ізохор, які є структурно та
функціонально мозаїчними. Було показано, що геном ссавців складається із
двох ГЦ-бідних родин ізохор (L1 i L2) та трьох ГЦ-багатих (Н1, Н2, Н3),
а у геномі птахів є ще ГЦ-найбагатша родина Н4 (Bernardi, 2000).

Таким чином, композиційний підхід дозволив розглянути процес інтеграції
на рівні компартментів геному, а не лише коротких фрагментів ДНК, які
оточують ретровіруси. Такі закономірності інтеграції було встановлено
при вивченні екзогенних ретровірусів, інтегрованих в геном ссавців. До
цього часу специфічність інтеграції вивчено тільки у одного ендогенного
ретровірусу – вірусу пухлини молочної залози мишей (MMTV) (Salinas et
al., 1987).

Ендогенні ретровіруси відрізняються від екзогенних низкою принципових
ознак. Перш за все, ендогенні ретровіруси є постійними компонентами
геному й існують, переважно, у вигляді провірусів. Лише деякі з них
продукують інфекційні віріони, які, проте, є непатогенними для їхніх
хазяїв. Інтеграція ендогенних ретровірусів відбулася порівняно давно,
внаслідок чого вони еволюціонували разом із геномом хазяїна протягом
тривалого періоду часу. Така коеволюція наклала відбиток на структуру
інтегрованих послідовностей: вони зазнали численних структурних
перебудов і втрат цілих генів. Різні строки інтеграції в геном хазяїна,
і, як наслідок, різна тривалість еволюційних змін, спричинили значне
різноманіття ендогенних ретровірусів. Особливо це стосується ендогенних
ретровірусів птахів, які є однією з найбільш досліджуваних груп
ретровірусів. Серед них розрізняють, як мінімум, три групи різного
еволюційного віку: ALV-родинні ретровіруси (споріднені з вірусом
лейкемії птахів), родина EAV (з підродинами EAV-0, E-51, E-33, ART-CH,
EAV-HP) і HERV-I–родинні ретровіруси (споріднені з ендогенним
ретровірусом людини типу I) (Borisenko, 2003).

При вивченні інтеграції екзогенних ретровірусів можна встановити лише
закономірності інтеграції в ту чи іншу ділянку геному, тоді як
дослідження розподілу ендогенних ретровірусів дозволяє побачити як
змінився такий розподіл внаслідок тривалого процесу коеволюції з геномом
хазяїна. З цього погляду важливо розглянути взаємозв’язок між
локалізацією ретровірусів у ізохорах та їх експресією, адже серед
ендогенних ретровірусів птахів багато послідовностей, які не
експресуються, а компартменталізованість та ізопікнічність інтеграції
характерна саме для транскрипційно активних провірусів (Zoubak et al.,
1994).

Таким чином, зв’язок між локалізацією ретровірусу в геномі, його
експресією, еволюційною історією – з одного боку, та розподілом генів у
ізохорах – з іншого, може дати інформацію не лише стосовно
закономірностей інтеграції ретровірусу і зміни місця його розташування в
геномі у процесі еволюції, але і поповнити дані про організацію геному
теплокровних хребетних в цілому.

Крім безсумнівного теоретичного інтересу, дослідження ендогенних
ретровірусів має велике практичне значення. Відомо, що ендогенні
ретровіруси обумовлюють несприятливість до інфікування екзогенними
ретровірусами та відіграють роль у виникненні нових вірулентних форм
ретровірусів. Останніми роками поява таких ретровірусів, за рахунок
рекомбінації з екзогенними ретровірусами, викликала значні збитки у
птахівництві в усьому світі.

Все це говорить про те, що проблеми взаємодії ендогенних ретровірусів з
геномом хазяїна залишаються актуальними та недостатньо вивченими.

Зв’язок роботи з науковими програмами, планами, темами. Робота
відповідає основному напрямку науково-дослідних робіт відділу
молекулярної онкогенетики ІМБіГ НАН України. Її виконано в рамках
бюджетної теми № 2.2.4.2 “Регуляція експресії генів при лейкозах” (№
держ. реєстрації: 0101U009210) і в рамках міжнародного проекту NATO
(LST.CLG9/6685).

Мета і завдання дослідження. Мета роботи – виявлення композиційних
закономірностей розподілу ендогенних ретровірусів у геномі птахів, та
можливої залежності між локалізацією провірусів у геномі та їх
транскрипцією. Для досягнення мети було поставлено такі завдання:

проаналізувати композиційні характеристики ендогенних ретровірусів
курки, нуклеотидні послідовності яких доступні із баз даних;

локалізувати в композиційних фракціях геномної ДНК курки 7 груп
ендогенних ретровірусів: ALV-родинні ретровіруси, HERV-I-родинні
ретровіруси, EAV-0, EAV-HP, Е-51, Е-33, ART-CH;

дослідити експресію цих ендогенних ретровірусів за допомогою ЗТ-ПЛР та
пошуку експресованих послідовностей в комп’ютерних базах даних.

Об’єктом дослідження є процес інтеграції ендогенних ретровірусів у геном
птахів. Предметом дослідження – специфічність інтеграції та її можливий
зв’язок із експресією ретровірусу. Методи дослідження: ПЛР,
рестрикційний аналіз, гібридизація за Саузерном, композиційне
фракціонування, ЗТ-ПЛР та аналіз комп’ютерних баз даних EST.

Наукова новизна одержаних результатів. На прикладі геному птахів у
роботі вперше проаналізовано композиційну специфічність розподілу
ендогенних ретровірусів. Показано компартменталізованість та
ізопікнічність їх розподілу. Вперше досліджено експресію трьох груп
ендогенних ретровірусів геному курки (Е-33, Е-51 і HERV-I-родинні
ретровіруси). Встановлено, які саме ALV-родинні ендогенні ретровіруси
представлені в геномі досліджуваної лінії курей СВ (В12/В12). Вперше
встановлено, що в геномі курей присутні не лише ендогенні ретровіруси,
споріднені з ALV, а є також HERV-I-родинні ретровіруси. Відкрито новий
HERV-I-родинний ретровірус із геному курки.

Практичне значення одержаних результатів. Результати роботи стосуються
однієї із сторін взаємодії геному хребетних та геному ретровірусу, яка
виявляється у вигляді специфічності інтеграції останнього.
Закономірності інтеграції є важливою характеристикою цієї взаємодії,
адже від положення ретровірусу в геномі залежить його активність, що, в
свою чергу, може впливати на здатність ендогенного ретровірусу брати
участь у формуванні високовірулентних форм екзогенних ретровірусів.
Отримані дані розширюють уявлення про встановлені раніше
закономірності інтеграції ретровірусів, які важливі у генній терапії,
де ретровіруси використовують як вектори.

Особистий внесок здобувача. Роботу було виконано під керівництвом
д.б.н., професора, член-кор. НАН України, зав. відділу молекулярної
онкогенетики ІМБіГ НАН України Риндич А.В. Весь обсяг експериментальної
роботи, а саме: приготування градієнтів, гібридизацію та дослідження
експресії, а також обробку й аналіз отриманих результатів та
формулювання висновків, виконано автором особисто. Автор висловлює
подяку к.б.н. Цибі Л.О. за допомогу у приготуванні деяких градієнтів,
Степанцю В. М. та доктору Хейнару Й. за надання ДНК і РНК, а також
професору Бернарді Д. за корисні поради при обговоренні результатів
дослідження.

Апробація результатів дисертації. Основні положення дисертації було
представлено на “Конференції з молекулярної біології і генетики для
студентів, аспірантів та молодих вчених” (Київ, 2001, 2003), III
Науково-практичній конференції “Проблеми онкогенетики: наукові та
прикладні аспекти” (Київ, 2002), VIII з’їзді Українського біохімічного
товариства (Чернівці, 2002), Конференції з порівняльної та
функціональної геноміки (Cambridgeshire, Great Britain, 2003) і наукових
семінарах відділів молекулярної онкогенетики та біосинтезу нуклеїнових
кислот ІМБіГ НАН України.

Публікації. За матеріалами дисертації опубліковано 5 статей (2 оглядові)
та тези 5 доповідей. Отримана автором нуклеотидна послідовність нового
HERV-I-родинного ретровірусу з геному курки має реєстраційний номер в
GenBank AY182230.

Структура та обсяг роботи. Дисертація складається із вступу, огляду
літератури, опису матеріалів і методів дослідження, отриманих
результатів, їх обговорення, висновків та списку використаної
літератури. Дисертацію викладено на 133 сторінках друкованого тексту;
вона містить 42 рисунки та 9 таблиць; список літератури охоплює 200
найменувань.

ОСНОВНИЙ ЗМІСТ

Матеріали і методи дослідження. Геномну ДНК, виділену із печінки та
крові дорослих курей лінії СВ (В12/В12), а також тотальну РНК із
фібробластів 18-денного ембріона та пухлин, індукованих у курей тієї ж
лінії ін’єкцією вірусного гена src, надано Степанцем В. М. та доктором
Хейнаром Й. (Інститут молекулярної генетики, м. Прага, Чехія).

Для виявлення ALV-родинних ретровірусів використовували полімеразну
ланцюгову реакцію (ПЛР) (Benkel, 1998) та метод поліморфізму довжини
рестрикційних фрагментів (ПДРФ) (Rovigatti, Astrin, 1983).
HERV-I-родинні ретровіруси виявляли за допомогою ПЛР з виродженими
праймерами для консервативних ділянок ретровірусних генів протеази та
зворотньої транскриптази (Tristem, 1996).

Композиційне фракціонування геномної ДНК курки проводили в пологому
градієнті густини CsCl (De Sario et al., 1995). Центрифугування робили у
вертикальному роторі VTi90 (“Beckman”, США) на препаративній центрифузі
“Beckman” при 35000 об/хв, 20°С, 24 години. Після цього збирали 60-65
фракцій (80 мкл кожна фракція) на колекторі фракцій DGF-U фірми
“Hitachi” (Японія). ГЦ-склад фракцій визначали за допомогою аналітичного
центрифугування з маркером плавучої густини – ДНК вірусу С2. Плавучу
густину досліджуваних фракцій розраховували виходячи із положень піків
досліджуваної ДНК та ДНК вірусу С2, а ГЦ-склад досліджуваних фракції –
за формулою ГЦ%=?-1,66/0,00098, де ? – плавуча густина досліджуваної
ДНК.

Присутність провірусів у фракціях ДНК виявляли за допомогою дот-блот
гібридизації, для чого ДНК денатурували в 0,4 М NаОН 10 хв і переносили
по 50 нг з кожної фракції на позитивно заряджену нейлонову мембрану. Для
гібридизації використовували такі типи зондів: 1) фрагмент вірусу
саркоми Рауса (RSV) без гена src та 3′ довгого кінцевого повтору (LTR);
2) зонди, отримані за допомогою ПЛР з використанням праймерів,
нуклеотидні послідовності яких було раніше опубліковано в літературі,
або підібрані за допомогою програми Primer3
(www-genome.wi.mit.edu/cgi-bin/primer); 3) олігонуклеотиди, підібрані за
допомогою програми Primer3 (табл.1). Умови ПЛР із самостійно підібраними
праймерами були такі: 50 mM KCl, 10 mM трис-HCl, pH 8,3 1,5 mM
MgCl2, 200 ?M dNTPs, 20 pM кожного праймера, 300
нг ге-

Таблиця 1

Зонди для гібридизації та праймери для ПЛР, які використовували для
локалізації ендогенних ретровірусів курки

Ретрові-рус Зонди і ПЛР-праймери (5′-3′) Специфічність Посилання

ALV-родинні RSV (7030 п.н.) ALV-родинні Katz et al., 1982

ART-CH ART.1-ART.2 (922 п.н.)

ART.1 tggataaaagaggcctgaa

ART.2 gttggcttcggtctgccaacg ART-CH Nikiforov, Gudkov, 1994

EAV-0 EAV0.1-EAV0.2 (135 п.н.)

EAV0.1 gggatgtaacgtgtcaggct

EAV0.2 atgatgagcggtaaaatggc EAV-0 Програма Primer3

HERV-I-родинні PRO-JO (856 п.н.)

PRO gt t/g tti g/t ti ga t/c aci ggi g/t c

JO ati agi a g/t a/g tc a/g tci ac a/g ta HERV-I-родинні Tristem,
1996

E-51 1) E51.1-E51.2 (218 п.н.)

E51.1 gccattttgctgctcatcatat

E51.2 gtcatgggttgatgcagtatc

2) E51.up-E51.down (235 п.н.)

E51.up ttctctgggaggtccatgtt

E51.down tgccaacctttctatctggg

3)E51LTR: atcagctaattggtcagtgagcgcagaggc Е-51,

Е-33 Boyce-Jacino et al., 1992

Програма Primer3

Te саме

E-33 1) E33.1-E33.2 (205 п.н.)

E33.1 gctgccgagaaaacaagaaa

E33.2 gccaaatgactgcaaacgta

2)E33LTR: gaggaagcaactaaataaggcacgatgttatcagt E-33,

E-51, ART-CH

“ ”

EAV-HP 1) H3-H4 (548 п.н.)

H3 aacaacaccgatttagccagc

H4 caacacctctggctgttccc

2) HP.up-HP.down (160 п.н.)

HP.up tgtgttgtaggcgtagcgag

HP.down gtgaggcaaatggcgtttat

3)HPLTR: gaggaaacacttgtatttaaacacgtagcc EAV-HP, E-51

EAV-HP

EAV-HP Smith et al., 1999

Програма Primer3

Те саме

Примітка. Назви зондів утворено від назв праймерів, які було використано
для їх приготування.

номної ДНК, 2 од. Taq-полімерази; температурні цикли: 94°С 3 хв, {94°С
1хв, 56°С 40 сек, 72°С 40 сек}-30 циклів, 72°С 7хв. Зонди мітили за
допомогою [?-??Р]dATP (олігонуклеотиди) та [?-??Р]dCTP з реактивами та
згідно інструкцій виробника (“Amersham”, Великобританія). Гібридизацію
проводили в розчині Rapid-hyb в умовах рекомендованих фірмою-виробником
(“Amersham”, Великобританія): олігонуклеотиди гібридизували 45 хв при
температурі 42°С, а довгі зонди – при 65°С, 2 години. Для кожного
ретровірусу проводили як мінімум п’ять гібридизацій. Кількісний аналіз
гібридизаційних сигналів робили за допомогою апарату “PhosphorImager”
(“Molecular Dynamics”, США) або програми Image Quant. Гаусові криві
інтенсивностей гібридизаційних сигналів будували за допомогою програми
IgorPro (“Wave Metrics”, США).

Для дослідження експресії ендогенних ретровірусів використовували
зворотньотранскриптазну полімеразну ланцюгову реакцію (ЗТ-ПЛР) на РНК із
фібробластів 18-денного ембріона та із пухлин, індукованих у курей
ін’єкцією вірусного гена src, з реактивами фірми “Roche” (Німеччина), а
також праймерами ART.1, ART.2, H3, H4, E51.up, E51.down, PRO, JO (табл.
1) та evFLR3 (gtcatcccttggggcaagacct), evFLF3
(gtatatcaccgcgctgttggactct) (для ev-1) (Johnson, Heneine, 2001),
EAV-0-pol-1 (cgggtgactgggaaattaga), EAV-0-pol-2 (tttcgcacatgaagaacagc),
E33.up (aacagactgaccttgctgcc), E33.down (caactgtgccgtcatgttct)
(підібрані за допомогою програми Primer3). ЗТ-ПЛР проведено в умовах,
рекомендованих фірмою-виробником реактивів; умови ПЛР для праймерів
EAV-0-pol-1, EAV-0-pol-2, E33.up, E33.down – такі ж, як і для інших
праймерів, підібраних самостійно. Для перевірки специфічності ЗТ-ПЛР
використовували Саузерн-гібридизацію в жорстких умовах. Зондами були
продукти ПЛР, отримані за допомогою тих же пар праймерів при
ампліфікації геномної ДНК; тільки у випадку ev-1 використовували
олігонуклеотидний зонд ev-gag-pol.1P (taacgcaattagtggaaaaagaat)
(Johnson, Heneine, 2001).

Додаткові дані про експресію ендогенних ретровірусів отримали із сайтів
Інституту експериментальної вірусології та імунології (м. Гамбург,
Німеччина) (http://swallow.gsf.de/dt40Est.html), в якому секвенують
клони нормалізованої бібліотеки кДНК курей лінії СВ (В12/В12), відділу
біомолекулярних наук Манчестерського університету (Великобританія)
(http://www.chick.umist.ac.uk), Інституту біотехнології (м. Делавер,
США) (http://www.chickest.udel.edu), а також бази даних GenBank (номери
нуклеотидних послідовностей: CD734212, CD737734, CD739800).

Для роботи було використано такі послідовності ендогенних ретровірусів
курки із бази даних GenBank (за станом на 1.05.2004): ev-1 (AY013303),
ART-CH (L25262), EAV-0 (M31063, X59844), E-33 (M95190), E-51 (M95189),
EAV-HP (AJ238124).

Результати дослідженя та їх обговорення. Фракціонування геномної ДНК
курки. Аналітичне центрифугування тотальної геномної ДНК курки в
градієнті густини CsCl показало, що її плавуча густина складає 1,69979
г/см?, що відповідає ГЦ-вмісту 40,6 %. Препаративне центрифугування
дозволило розділити градієнт геномної ДНК на 48 фракцій, різних за
плавучою густиною та ГЦ-вмістом. Аналіз показав, що ізохорні родини
геному курки разюче відрізняються за відносною кількістю ДНК. Так,
ГЦ-бідні ізохори L1 i L2 складають 67% всієї ДНК.

Композиційний аналіз геномів ендогенних ретровірусів курки. Раніше, на
основі аналізу композиційного складу, було встановлено, що існує два
композиційні класи ретровірусів: ГЦ-бідний (ГЦ-склад – до 50%) і
ГЦ-багатий (Zoubak et al., 1992). Перший містить лентівіруси,
спумавіруси, ретровіруси В-типу і деякі ретровіруси D-типу. Інші
ретровіруси належать до ГЦ-багатого класу. Аналіз геномів ендогенних
ретровірусів курки показав, що серед них є ретровіруси як ГЦ-багатого
(ALV-родинні ретровіруси, EAV-HP, EAV-0), так і ГЦ-бідного
(HERV-I-родинні ретровіруси) класів. Споріднені ретровіруси Е-33 та
Е-51, як і близький до них ретротранспозон ART-CH, мають ГЦ-склад
близько 50% (табл. 2). Як видно із таблиці, ГЦ-вміст LTR завжди нижчий
за ГЦ-вміст генів (за винятком EAV-HP). Цей факт характерний тільки для
ретровірусів птахів (Zoubak et al., 1992). З усіх ретровірусних генів,
найнижчий ГЦ-склад завжди має ген env.

ALV-родинні ретровіруси в геномі курей лінії СВ (В12/В12). Для кожної
лінії курей характерний свій набір ALV-родинних провірусів. Методами ПЛР
та ПДРФ ми встановили, що в геномі лінії СВ (В12/В12) є три провіруси
цієї родини: ev-1, ev-7 i ev-10. Як відомо із даних літератури, всі вони
можуть продукувати неінфекційні віріони (Robinson et al., 1979).

Таблиця 2

ГЦ-склад ендогенних ретровірусів курки

Ретровірус ГЦ-склад

повного провірусу LTR gag pol env

ev-1 52,5 44,5 56,6 53,4 48,2

EAV-HP 53,1 53,2 56,1 52,9 47,1

EAV-0 54,3 49,8 56,3 53,8 45,0

E-51, Е-33 50,1 47,8 53,6 51,3 45,9

ART-CH 51,4 49,0 52,0

HERV-I-родинні ? ? ? 42,3 ?

Примітки: 1. Послідовність між LTR ART-CH містить частину гена gag; 2. ?
– дані відсутні.

HERV-I-родинні ретровіруси геному курки. Раніше вважалося, що в геномі
курки є тільки провіруси, які походять від ретровірусів роду ALV. При
проведенні ПЛР на геномній ДНК курки із виродженими праймерами для
консервативних ділянок ретровірусних генів протеази та зворотньої
транскриптази, нам вдалось ампліфікувати гени pro і pol, після
секвенування яких було встановлено, що вони належать новому ретровірусу,
спорідненому з ендогенним ретровірусом людини типу I (HERV-I). Подібні
HERV-I-родинні ретровіруси було раніше знайдено в геномі горобця і
деяких інших хребетних (Martin et al., 1997). Всі вони належать до роду
MLV (віруси, споріднені з вірусом лейкемії мишей) та інфікували птахів у
результаті горизонтального переносу (Martin et al., 1999).

Розподіл ендогенних ретровірусів у геномі курки.

ALV-родинні ретровіруси. Зонд, який ми використовували для локалізації
ALV-родинних провірусів (див. табл. 1), у жорстких умовах гібридизується
з усіма провірусами цієї групи. При гібридизації на двох різних
градієнтах (рис. 1, А, Б) спостерігається однакова картина розподілу
ретровірусів. Чіткий пік припадає на ділянку 55-57% ГЦ, що відповідає
межі між ізохорами Н3 і Н4. ГЦ-склад ретровірусів (52,5 %) добре
збігається із ГЦ-складом піків.

< ‚ < E a$ & wAewAEwewewuwocUeccOoA u {({*{8{:{<{J{p{r{”{–{¦{ooooooooocoUoU dh]„yy 1^ ` „ ? ” ? ¤ ocUccc A!I!Oe!a!a!ae!ae!ooooo:?kd„ V 1/4 ?54,3 %), що свідчить про типову ізопікнічну локалізацію EAV-0. Провіруси Е-33, Е-51 і ретротранспозон ART-CH. Як показує аналіз бази даних геному курки, Е-33, Е-51 та ART-CH є близькоспорідненими ретроелементами, а тому їх складно розділити в процесі гібридизації (Borisenko, Rynditch, 2004). При гібридизації зондом ART.1-ART.2 спостерігаються три чіткі піки розподілу: на 55% ГЦ, 59% ГЦ і 64% ГЦ (рис. 2, А). Ці результати вказують на локалізацію ретровірусів, переважно, в ГЦ-найбагатших ізохорах Н3 і Н4. Гібридизація зондами E51.up-E51.down та E51LTR (рис. 2, Б, В) дозволяє побачити пік розподілу на 46-47%, що відповідає родині ізохор Н1. Локалізація цих провірусів у ГЦ-багатих ізохорах є ізопікнічною. Проте, гібридизація на ДНК із печінки зондами E33LTR та E33.1-E33.2 виявляє додатковий пік розподілу, що лежить в неізопікнічній ділянці на 39 %ГЦ (межа ГЦ-бідних ізохор L1 та L2) (рис. 2, Г, Д). HERV-I-родинні ретровіруси. ГЦ-бідні провіруси мають два піки розподілу: на 42% ГЦ та 49% ГЦ (рис. 3, А), причому ГЦ-склад першого піку збігається з ГЦ-складом зонду, який використовували для гібридизації (42,3% ГЦ). Таким чином, якщо перший пік вказує на місце постійної локалізації цих провірусів, то другий пік міг утворитися внаслідок їх реінтеграції. Перший пік знаходиться в ГЦ-бідній родині ізохор L2, а другий – у H2. Провірус EAV-HP. ГЦ-багатий провірус EAV-HP характеризується присутністю як в ГЦ-багатих, так і в ГЦ-бідних ізохорах. Гібридизація на ДНК із печінки демонструє три піки розподілу: крім ізопікнічного піку в ГЦ-багатій частині (57-58% ГЦ), який лежить на межі ізохор Н3 і Н4 і відповідає ГЦ-складу ретровірусу EAV-HP (53,1% ГЦ), є додаткові піки на межі ізохор L1 i L2 (39-40% ГЦ) та Н1 і Н2 (47-48% ГЦ) (рис. 3, Б, В). Всі піки на ДНК із крові трохи зсунуті в напрямку ГЦ-бідних фракцій: вони включають 37-38% ГЦ (родина ізохор L1), 45% ГЦ (L2) та 53% ГЦ (Н3) (рис. 3, Г). Як і у випадку повторюваних послідовностей геному ссавців – Alu-повторів та LINE, а також ретротранспозону геному курки CR1, причиною ізопікнічної локалізації ендогенних ретровірусів (ГЦ-багатих ALV-родинних ретровірусів, EAV-0, Е-33/Е-51 і ГЦ-бідних HERV-I-родинних ретровірусів) може бути стабільність такої локалізації, а також ступінь впливу інтегрованої послідовності на функціонування сусідніх генів (Bernardi, 2004). У зв’язку з тим, що ГЦ-бідні ізохори, де EAV-HP і частина Е-33/Е-51 мають чіткі піки локалізації, містять більше тканиноспецифічних та регульованих на різних стадіях розвитку генів ніж ГЦ-багаті (Bernardi, 2000), можна припустити, що ці провіруси мають невідому функцію, яка пов’язана із генами, локалізованими у ГЦ-бідних ізохорах. Відомо, що деякі ендогенні ретровіруси людини можуть мати функцію, пов’язану з розвитком, а значить вони асоційовані з регульованими на різних стадіях онтогенезу генами (Griffiths, 2001). На користь припущення про функцію EAV-HP може свідчити наявність у цього ретровірусу сайтів для приєднання регулятора транскрипції СССТ-зв’язувального фактора (CTCF) (Sacco et al., 2000). Подібні сайти є також у провірусів Е-33 і Е-51. Ізопікнічність локалізації характерна для груп ендогенних ретровірусів різного еволюційного віку. Що стосується порівняння локалізації екзогенних та ендогенних ретровірусів, то для екзогенного RSV (ГЦ-склад 54%), спорідненого із ендогенними ALV-родинними провірусами, раніше було показано, що при інтеграції в геном хом’яка він має пік розподілу в ділянці 50% ГЦ, тобто локалізований, переважно, в родині ізохор Н2 (Rynditch et al., 1991); за нашими даними ALV-родинні ретровіруси (52,5% ГЦ) в геномі курки мають пік розподілу на 55-57% ГЦ (межа ізохор Н3 та Н4). Таким чином, у останньому випадку ізопікнічність локалізації виражена яскравіше. Експресія ендогенних ретровірусів у геномі курки. Дослідження експресії за допомогою ЗТ-ПЛР. Аналіз експресії за допомогою зворотньотранскриптазної полімеразної ланцюгової реакції на РНК із ембріональних фібробластів та v-src-індукованих пухлин вказує на транскрипцію п’яти ретровірусів (EAV-0, EAV-HP, Е-51, Е-33 та HERV-I-родинних ретровірусів), причому картина експресії однакова в обох випадках (рис. 4). Нам не вдалося встановити факту експресії ALV-родинного ретровірусу ev-1 та ретротранспозону ART-CH. Експресію інших ALV-родинних ретровірусів, які присутні в геномі лінії СВ (В12/В12) – ev-7 та ev-10, не досліджували, тому що їхню нуклеотидну послідовність ще не встановлено. Пошук експресованих послідовностей у базах даних. Експресію ретровірусів у інших тканинах було досліджено шляхом аналізу баз даних EST. В цілому, ретровірусні послідовності було знайдено у 21 тканині та типі клітин (табл. 3). HERV-I-родинні ретровіруси можуть не експресуватись у досліджених тканинах, оскільки у базах даних їхні послідовності не знайдено. Таблиця 3 Експресія ендогенних ретровірусів курки в різних тканинах (на основі аналізу баз даних EST) Тканина чи тип клітин Ретровірус ALV-родинні ART-CH EAV-0 EAV-HP E-33/ Е-51 1. підшлункова залоза (д.) + + 2. серце (д.) + + + + 3. печінка (д.) + + + 4. півкулі головного мозку (д.) + + + 5. мозочок (д.) + + 6. мозок-інші частини (д.) + + + 7. мозок 16-денного ембріона + + 8. тонкий кишечник (д.) + + 9. нирки і наднирники (д.) + + + + 10. яєчник (д.) + + + + + 11. культура хондроцитів + + 12. ембріональна стадія 10 + + + + 13. стадія 20-21 + + + + 14. стадія 22 + + + + + 15. стадія 36 + + + + + 16. жирова тканина + + + + 17. Т-клітини селезінки + 18. лімфоїдна тканина + 19. гіпофіз + 20. інтестінальні лімфоцити + + 21. бурса + + Примітки: 1. тканини 1-15 – із бази даних BBSRC, 16-19 – із бази даних Університету Делавера, 20 – із GenBank, 21 – з бази даних Інституту Heinrich-Pette (м. Гамбург, Німеччина); 2. лімфоїдна тканина містить суміш тимусу, бурси, селезінки, лімфоцитів крові та кістковий мозок; 3. + - ретровірусні послідовності знайдено; 4. д – дорослі особини. Майже всі досліджені тканини та типи клітин містили ретровірусні послідовності. Винятком є лише м’язова тканина та макрофаги. Що стосується тканин, які ми використовували для приготування градієнтів, то у печінці, як і у клітинах крові, ретровіруси активно експресуються: ALV-родинні ретровіруси, ART-CH, EAV-0 – у печінці; ALV-родинні ретровіруси, ART-CH, Е-33/Е-51, EAV-HP – у клітинах крові (таких як В-лімфоцити, Т-лімфоцити, інтестинальні лімфоцити та у лімфоїдній тканині). Крім тканиноспецифічного характеру експресії, нами виявлено різницю у кількості різних ретровірусних генів у базах даних EST. ALV-родинні ретровіруси, які найактивніше експресуються у підшлунковій залозі та у серці, мають делетовані pol-транскрипти, що представлені у невеликих кількостях. Транскрипти ART-CH включають всю довжину ретротранспозону. Транскрипти EAV-0 представлені, головним чином, геном env; у менших кількостях присутні pol-транскрипти, які не знайдено у інших ретровірусів та gag-послідовності, які ще не описано в літературі. EAV-HP експресується, переважно, у підшлунковій залозі; кількість env-транскриптів цього ретровірусу значно більша за кількість gag-транскриптів. Незважаючи на те, що досліджені нами ретровіруси мають піки розподілу в ізопікнічних ізохорах, різний рівень експресії ретровірусу в різних тканинах може впливати на картину його локалізації внаслідок реінтеграції. В результаті, можуть з’являтись додаткові піки в ГЦ-багатих ізохорах, у ділянках з відкритою структурою хроматину. Такі піки можна бачити у ART-CH та HERV-I-родинних ретровірусів (див. рис. 2, А; 3, А). EAV-HP та Е-33/Е-51, які мають додаткові піки в ГЦ-бідних ізохорах, імовірно містять сайти для приєднання регулятора транскрипції CTCF, що зумовлює їх взаємодію із сусідніми генами, адже наявністю саме регульованих на різних етапах онтогенезу генів характеризуються ГЦ-бідні ізохори. ВИСНОВКИ У дисертаційній роботі вперше досліджено розподіл семи груп ендогенних ретровірусів у геномі курки та їх експресію. 1. Показано ізопікнічність локалізації ендогенних ретровірусів геному курки: ГЦ-багаті ретровіруси (ALV-родинні провіруси, ретровіруси EAV-0, Е-33, Е-51, ART-CH) зосереджені в ГЦ-багатих ізохорах, ГЦ-бідний HERV-I-родинний провірус локалізований в ГЦ-бідних ізохорах. Частина ГЦ-багатих ретровірусів групи Е-33/Е-51, а також ГЦ-багатий ретровірус EAV-HP мають додаткові піки локалізації в неізопікнічних ГЦ-бідних ізохорах. 2. Виявлено, що експресія ендогенних ретровірусів курки є тканиноспецифічною. Вперше досліджено експресію трьох груп ендогенних ретровірусів: Е-33, Е-51 і HERV-I-родинних провірусів. 3. Встановлено, що локалізація ендогенних ретровірусів у геномі не визначається їх еволюційним віком, а залежить від їх композиційного складу. Разом з тим, провіруси екзогенного походження можуть бути локалізовані більш широко, ніж споріднені з ними ендогенні. 4. З’ясовано, які саме ендогенні ретровіруси присутні в геномі лінії курей СВ (В12/В12). 5. Вперше показано, що в геномі курки є не лише ретровіруси, споріднені з ALV. Вивлено новий HERV-I-родинний ретровірус, який споріднений з MLV. 6. Доповнено дані про існування двох класів ретровірусів: ГЦ-багатого та ГЦ-бідного. У геномі курки є представники обох цих класів. ПЕРЕЛІК НАУКОВИХ ПРАЦЬ, ОПУБЛІКОВАНИХ ЗА ТЕМОЮ ДИСЕРТАЦІЇ 1. Борисенко Л.Г., Рындич А.В. Эндогенные ALV-родственные ретровирусы в ДНК кур линии СВ // Біополімери і клітина. – 2003. – Т. 19, №1 – С. 71-75. Особистий внесок здобувача – з’сування які ALV-родинні ретровіруси присутні в геномній ДНК курей лінії СВ (В12/В12) і визначення закономірностей їх розподілу в геномі. 2. Борисенко Л.Г., Рындич А.В. Новый эндогенный ретровирус из генома курицы // Біополімери і клітина. – 2003. – Т. 19, № 3. – С. 270-273. Особистий внесок здобувача – клонування генів протеази та зворотньої транскриптази нового HERV-I-родинного ретровірусу із геному курки, проведення його філогенетичного аналізу та дослідження його експресії. 3. Borisenko L., Rynditch A.V., Bernardi G. Distribution and expression of chicken endogenous retroviruses in the host genome // Біополімери і клітина. – 2004. – Т. 20, №1-2. – С. 51-60. Особистий внесок здобувача – визначення закономірностей розподілу семи груп ендогенних ретровірусів у геномі курки та дослідження їх експресії. 4. Борисенко Л.Г., Рындич А.В. Эндогенные ретровирусы птиц: структура, экспрессия и эволюция // Біополімери і клітина. – 2002. – Т.18, №1 – С. 37-47. Особистий внесок здобувача – аналіз даних літератури про різноманіття, структуру та експресію ендогенних ретровірусів птахів. 5.Borisenko L. Avian endogenous retroviruses // Folia biologica (Praha). – 2003. – Vol. 49, №.5. – P. 177-182. Особистий внесок здобувача – аналіз даних літератури про різноманіття, структуру, експресію та роль ендогенних ретровірусів птахів. 6. Borisenko L.G., Rynditch A.V. Endogenous sequences in the genome of vertebrates: evidence for their non-uniform localization in the host genomes // Conference for students, PhD students and young scientists on molecular biology and genetics. – Kyiv (Ukraine). – 2001. – P.28. Особистий внесок здобувача – визначення закономірностей розподілу трьох груп ендогенних ретровірусів у геномі курки. 7. Борисенко Л.Г., Риндич А.В. Регіональна специфічність інтеграції ендогенних ретровірусів в геном птахів // III Науково-практична конференція “Проблеми онкогенетики: наукові та прикладні аспекти”. – Київ (Україна). – 2002. – С.8. Особистий внесок здобувача – визначення закономірностей розподілу чотирьох груп ендогенних ретровірусів у геномі курки. 8. Борисенко Л.Г., Рындич А.В. Компартментализация эндогенных ретроэлементов в геноме клетки хозяина // VIII з’їзд Українського біохімічного товариства, Чернівці (Україна), 2002. – Український біохімічний журнал. – 2002. – Т.74, №4б (додаток 2). – С.22. Особистий внесок здобувача – визначення закономірностей розподілу п’яти груп ендогенних ретровірусів у геномі курки. 9. Borisenko L., Rynditch A.V. Chicken endogenous retroviruses: expression and regional specificity of integration // Conference for students, PhD students and young scientists on molecular biology and genetics. – Kyiv (Ukraine). – 2003. – P. 50. Особистий внесок здобувача – визначення закономірностей розподілу п’яти груп ендогенних ретровірусів у геномі курки та дослідження їх експресії. 10. Rynditch A., Borisenko L., Tsyba L., Bernardi G. Compositional localization of retroviral sequences in the host genomes and their expression // Comparative and functional genomics workshop. – Cambridgeshire (Great Britain). – 2003. – P. 35. Особистий внесок здобувача – визначення закономірностей розподілу семи груп ендогенних ретровірусів у геномі курки. АНОТАЦІЯ Борисенко Л.Г. Розподіл і експресія ендогенних ретровірусів у геномі птахів. – Рукопис. Дисертація на здобуття наукового ступеня кандидата біологічних наук за спеціальністю 03.00.03 – молекулярна біологія. – Інститут молекулярної біології і генетики НАН України, Київ, 2004. Дисертацію присвячено проблемі специфічності локалізації та експресії ендогенних ретровірусів у геномі птахів. Вперше досліджено розподіл семи груп ендогенних ретровірусів геному курки (ALV-родинні, HERV-I-родинні, EAV-HP, EAV-0, E-33, E-51, ART-CH) залежно від композиційного складу (варіювання ГЦ-вмісту) геному хазяїна. Встановлено, що локалізація провірусів є ізопікнічною, тобто ГЦ-склад провірусу близький до ГЦ-складу ділянки геному хазяїна, куди він інтегрований. Частина ретровірусів групи Е-33/Е-51, а також ретровірус EAV-HP мають додаткові піки в неізопікнічних ділянках. Показано, що експресія ендогенних ретровірусів геному курки є тканиноспецифічною, що, в свою чергу, може впливати на картину провірусної локалізації внаслідок реінтеграції. Вперше встановлено, що в геномі курки присутні не лише ретровіруси, споріднені з вірусом лейкозу птахів, а й ретровіруси, споріднені з ендогенним ретровірусом людини типу I (HERV-I). Ключові слова: локалізація ретровірусів, ендогенні ретровіруси курки, ізохори, експресія. АННОТАЦИЯ Борисенко Л.Г. Распределение и экспрессия эндогенных ретровирусов в геноме птиц. – Рукопись. Диссертация на соискание ученой степени кандидата биологических наук по специальности 03.00.03 – молекулярная биология. – Институт молекулярной биологии и генетики НАН Украины, Киев, 2004. Диссертация посвящена проблеме специфичности локализации и экспрессии эндогенных ретровирусов в геноме птиц. Впервые исследовано распределение семи групп эндогенных ретровирусов генома курицы (ALV-родственные, HERV-I-родственные ретровирусы, EAV-HP, EAV-0, E-33, E-51, ART-CH) в зависимости от композиционного состава (варьирования ГЦ-содержания) генома хазяина. ГЦ-богатые ALV-родственые ретровирусы (ГЦ-состав – 52,5 %) демонстрируют пики распределения в районе 55-57 % ГЦ. Гибридизация позволяет локализовать все три ALV-родственых провируса (ev-1, ev-7, ev-10), которые присутствуют в ДНК исследованой нами линии кур CB (B12/B12). Пики распределения ALV-родственых ретровирусов находятся на границе ГЦ-богатых изохор Н3 и Н4. ГЦ-богатый ретровирус EAV-0 (ГЦ-состав – 54,3 %) имеет пик распределения на 48% ГЦ, который лежит в ГЦ-богатом семействе изохор Н2. Родственные провирусы Е-33 и Е-51, для которых характерен промежуточный между ГЦ-богатыми и ГЦ-бедными ретровирусами ГЦ-состав (50,1 %), локализованы в районах 46-47% ГЦ (семейство изохор Н1) и 55-56% ГЦ (граница Н3 и Н4). Часть провирусов этой группы демонстрирует дополнительный пик распределения на 39% ГЦ (район перекрытия ГЦ-бедных изохор L1 и L2). ГЦ-богатый ретротранспозон ART-CH (ГЦ-состав – 51,4 %), родственный ретровирусам Е-33 и Е-51, имеет три пика распределения: в районе с ГЦ-составом 55%, 59% и 64%. Все они находятся в ГЦ-богатых изохорах Н3 и Н4. ГЦ-бедные HERV-I-родственные ретровирусы (ГЦ-состав – 42,3 %) демонстрируют два пика распределения: на 42% ГЦ и 49% ГЦ, которые находятся в ГЦ-бедном семействе изохор L2 и ГЦ-богатом Н2 соответственно. Предполагается, что первый пик обозначает место постоянной локализации провирусов, а второй пик мог образоваться в результате их реинтеграции. ГЦ-богатый ретровирус EAV-HP (ГЦ-состав – 53,1 %) обнаружен как в ГЦ-богатых, так и в ГЦ-бедных изохорах. Гибридизация на ДНК из печени демонстрирует три пика распределения: два пика в ГЦ-богатых компартментах (на 57-58% ГЦ и 47-48% ГЦ), которые лежат на границе изохор Н3-Н4 и Н1-Н2 соответственно, и пик на границе ГЦ-бедных изохор L1-L2 (на 39-40% ГЦ). Все пики на ДНК из крови слегка сдвинуты в направлении ГЦ-бедных фракций: они включают 37-38% ГЦ (семейство изохор L1), 45% ГЦ (L2) и 53% ГЦ (Н3). Таким образом, исследованные ретровирусы характеризуются присутствием изопикничного пика локализации в геноме хозяина (т.е. ГЦ-состав ретровируса близок к ГЦ-составу участка генома хазяина, куда он интегрирован). ГЦ-богатые ALV-родственные провирусы, провирус EAV-0, а также ретровирусы группы Е-33/Е-51 и ретротранспозон ART-CH локализированы, преимущественно, в ГЦ-богатых семействах изохор Н1, H2, Н3 и Н4, которые композиционно тождественны ГЦ-составу этих ретровирусов. ГЦ-бедные HERV-I-родственные ретровирусы локализированы в ГЦ-бедном семействе изохор L2. ГЦ-богатый ретровирус EAV-HP, а также часть ретровирусов группы Е-33/Е-51, кроме пика в ГЦ-богатых семействах изохор, имеют дополнительные пики распределения в ГЦ-бедных компартментах. Изопикничность локализации характерна для эндогенных ретровирусов разного эволюционного возраста. При сравнении распределения родственных екзогенных и эндогенных ретровирусов можно видеть, что в последнем случае изопикничность выражена более ярко: провирусы экзогенного происхождения могут быть распределены более широко, в то время как эндогенные ретровирусы сосредоточены, главным образом, в изопикничных участках генома хазяина. Исследование экспрессии при помощи RT-PCR, а также анализ баз даных EST свидетельствует, что экспрессия эндогенных ретровирусов генома курицы может быть тканеспецифична. Это в свою очередь может влиять на картину провирусной локализации вследствие реинтеграции. RT-PCR показывает, что в эмбриональных фибробластах и в v-src-индуцированных опухолях транскрибируются пять ретровирусов (EAV-0, EAV-HP, Е-51, Е-33 и HERV-I-родственные ретровирусы). Данные по экспрессии Е-33, Е-51, и HERV-I-родственных ретровирусов получены нами впервые. При анализе баз даных EST ретровирусные последовательности были найдены в 21 ткани и типе клеток. Исключения составляют только мышечная ткань и макрофаги. Последовательности HERV-I-родственных ретровирусов в базах даных EST не обнаружены. Ретровирусы активно экспрессируются в тканях, ДНК из которых использована для приготовления градиентов: ALV-родственные ретровирусы, ART-CH, EAV-0 – в печени; ALV-родственные ретровирусы, ART-CH, Е-33/Е-51, EAV-HP – в клетках крови. В работе впервые показано, что в геноме курицы присутствуют не только провирусы, родственные вирусу лейкоза птиц (ALV). Секвенированы гены протеазы и обратной транскриптазы нового ретровируса, родственного эндогенному ретровирусу человека типа I (HERV-I). На основании анализа геномов эндогенных ретровирусов курицы дополнены данные о существовании двух композиционных класов ретровирусов: ГЦ-богатого и ГЦ-бедного, которые могли образоваться вследствие их коэволюции с различными изохорами генома хозяина. В геноме курицы есть представители обоих этих классов. Ключевые слова: локализация ретровирусов, эндогенные ретровирусы курицы, изохоры, экспрессия. SUMMARY Borisenko L.G. Distribution and expression of endogenous retroviruses in the avian genome. – Manuscript. Thesis for a degree of Doctor of Philosophy (Ph.D) in Biology, speciality 03.00.03 – molecular biology. – Institute of Molecular Biology and Genetics of National Academy of Sciences of Ukraine, Kyiv, 2004. The dissertation is devoted to the problem of specificity of localization and expression of avian endogenous retroviruses in the host genome. Distribution of seven groups of chicken endogenous retroviruses (ALV-related ev loci, HERV-I-related proviruses, EAV-HP, EAV-0, E-33, E-51, ART-CH) was studied according to the composition (long-range variation of GC-content) of the host genome. It has been established that the localization of retroviruses was isopycnic which means that GC-content of provirus matches GC-level of host genome region where integration took place. Some proviruses of E-33/E-51 group and provirus EAV-HP have additional peaks in non-isopycnic regions. Investigation of expression provided a tissue-specific patterns that could change the picture of proviral distribution due to reintegration. It has been shown that the chicken genome contains not only ALV-related proviruses but also HERV-I (human endogenous retrovirus type I)-related. Key words: retrovirus localization, chicken endogenous retroviruses, isochores, expression. PAGE 1

Похожие записи