Національна академія наук України

Інститут молекулярної біології ТА генетики

Тихонкова Ірина Олександрівна

УДК 577.2

577.27

Пошук і характеристика пухлиноасоційованих антигенів раку щитовидної
залози та меланоми людини

03.00.03 — молекулярна біологія

АВТОРЕФЕРАТ

дисертації на здобуття наукового ступеня

кандидата біологічних наук

Київ-2006

Дисертацією є рукопис.

Роботу виконано у відділі структури та функцій нуклеїнових кислот
Інституту молекулярної біології та генетики НАН України.

Науковий керівник: доктор біологічних наук,

старший науковий співробітник

Філоненко Валерій Вікторович,

Інститут молекулярної біології та генетики

НАН України,

завідувач відділу структури та функцій нуклеїнових кислот.

Офіційні опоненти: доктор біологічних наук, професор,

член-кореспондент НАН України

Риндич Алла Володимирівна,

Інститут молекулярної біології та генетики

НАН України,

завідувач відділу молекулярної онкогенетики;

кандидат біологічних наук

Міхалап Світлана Віталіївна,

Інститут експериментальної патології, онкології і радіобіології ім. Р.Є.
Кавецького НАН України, старший науковий співробітник лабораторії
сигнальних каскадів клітин.

Провідна установа: Інститут біології клітини НАН України, м. Львів.

Захист відбудеться „20” червня 2006 року о 10 годині на засіданні
спеціалізованої вченої ради Д 26.237.01 Інституту молекулярної біології
та генетики НАН України за адресою: 03680, м. Київ-680, вул.
Заболотного, 150.

З дисертацією можна ознайомитись у бібліотеці Інституту молекулярної
біології та генетики НАН України.

Автореферат розіслано 19 травня 2006 року.

Вчений секретар

спеціалізованої вченої ради,

кандидат біологічних наук О.В. Підпала

Загальна характеристика роботи

Актуальність теми. За даними Всесвітньої організації охорони здоров’я,
онкологічні захворювання посідають друге місце серед причин людської
смертності після серцево-судинних. З року в рік їхня кількість зростає,
зокрема, у регіонах, які характеризуються несприятливим екологічним
станом. Також однією з причин цього є недостатня кількість і якість
засобів ранньої діагностики онкозахворювань та нових ефективних підходів
до лікування. Беручи до уваги суттєві відмінності антигенних профілів
нормальних і злоякісно трансформованих клітин, перспективним є
імунологічний підхід, тобто пошук або створення антитіл, здатних
розрізняти нормальні і злоякісно трансформовані клітини (Nicolette et
al., 2003). На сьогодні наявність імунної відповіді організму на
антигени пухлинних клітин є поза сумнівом. Акумульовано
експериментальний матеріал стосовно виявлення гуморальної та клітинної
відповіді на велику кількість антигенів асоційованих з пухлинами. Деякі
з цих білків використовують як маркери злоякісних новоутворень, а
моноклональні антитіла проти них або їхніх фрагментів – як терапевтичні
засоби.

Бурхливий розвиток молекулярної біології останніх десятиліть дав змогу
ідентифікувати гени, продукти яких беруть участь у малігнізації тканин.
У даній роботі використано найдосконаліший на сьогодні варіант
імунологічної детекції пухлиноасоційованих антигенів (ПАА) – SEREX
(serological analysis of recombinant expression cDNA libraries) для
ідентифікації їх у злоякісних пухлинах щитовидної залози людини та
меланоми (Chen et al., 1997).

Ідентифікація і характеристика ПАА раку щитовидної залози і меланоми
людини потрібна при доборі потенційних маркерів для діагностики ранніх
стадій розвитку цих новоутворень. Вибір об’єкта дослідження пов’язаний з
підвищенням після Чорнобильської катастрофи частоти захворюваності на
рак щитовидної залози серед дорослого населення в 2 рази, а серед дітей
— втричі. У той же час розвиток цих пухлин є досить повільним,
метастазування спостерігається рідко і прогноз часто буває позитивним.
Іншим перебігом захворювання відзначається меланома — агресивна пухлина
з швидким ростом, розвиток якої супроводжується частим метастазуванням
(Kabbarah et al., 2005).

Зв’язок роботи з науковими програмами, планами, темами. Роботу
проведено в рамках наукової тематики відділу структури та функцій
нуклеїнових кислот Інституту молекулярної біології та генетики НАН
України за бюджетними темами: № 2.28.2.8 — ”Ідентифікація та
характеристика пухлинних антигенів раку щитовидної залози людини” (номер
державної реєстрації 0198U001167, 1998-2000 рр.), № 2.2.4.10. —
“Дослідження сигнальних шляхів при злоякісній трансформації та пошук
пухлино-специфічних антигенів” (номер державної реєстрації 0101U000360,
2001-2005 рр.), грантом INTAS 97-030890, 1998-2000 рр. та Intas грантом
для молодих науковців YSF 01/1-0180.

Мета та завдання роботи. Метою дослідження був пошук і характеристика
антигенів асоційованих з раком щитовидної залози та меланомою людини.

Для досягнення поставленої мети було поставлено такі завдання:

Обрати та налагодити метод для пошуку антигенів, асоційованих з раком
щитовидної залози і меланоми.

Створити експресуючі кДНК-бібліотеки пухлин щитовидної залози і
меланоми.

Проскринувати кДНК бібліотеки аутологічними сироватками онкологічних
хворих для виявлення клонів імуногенних білків і пептидів.

Ідентифікувати і охарактеризувати одержані антигени.

Здійснити гетерологічне скринування ідентифікованих антигенів.

Провести імунологічні і біохімічні дослідження найімунореактивніших із
них.

Об’єкт дослідження: виявлення імунною системою людини антигенного
репертуара пухлин щитовидної залози і меланоми.

Предмет дослідження: антигени, асоційовані з пухлинами раку щитовидної
залози і меланоми.

Методи дослідження: конструювання експресуючих кДНК бібліотек,
серологічне скринування, робота з базами даних нуклеїнових кислот та
білків, конструювання плазмідних векторів, полімеразна ланцюгова
реакція, афінна хроматографія і гель-фільтрація, електрофорез білків у
ПААГ за денатурувальних умов та нуклеїнових кислот в агарозному гелі,
Вестерн-блот та імуно-дот-блот аналіз, імуноферментний аналіз (ELISA).

Наукова новизна одержаних результатів. Вперше в Україні застосовано
метод SEREX для пошуку ПАА. Вперше в світі використано його для
ідентифікації антигенів, асоційованих з раком щитовидної залози та
ідентифіковано 45 імунопозитивних клонів, які містять кДНК антигенів і
кодуються 33 генами. Знайдено 10 імунореактивних клонів для меланоми
людини, які є фрагментами 4 генів. Їх охарактеризовано та проведено
гетерологічний скринінг. Показано підвищений рівень аутоантитіл проти
ядерного антигену Кі-67 у 44 % сироваток хворих на меланому, 30 % — на
рак молочної залози, 33 % — на рак щитовидної залози.

Виявлено взаємодію рекомбінантного фрагмента ядерного антигену Кі-67,
одного з найбільш імунореактивних серед ідентифікованих ПАА, з ДНК, що
може бути підґрунтям для встановлення функції цього білка.

Практичне значення одержаних результатів. Враховуючи зростання частоти
захворюваності на рак щитовидної залози в Україні, успішне застосування
методу SEREX для пошуку пухлиноасоційованих антигенів при даній
патології є перспективним напрямком у створенні тестів для ранньої
діагностики захворювання і терапевтичних засобів. Зокрема, серед
виявлених антигенів найперспективнішими можна вважати Кі-67, б- катенін,
тимозин бета та білок, асоційований з солідними пухлинами,
імунореактивність проти яких сироваток крові хворих була достовірно
вищою порівняно з такою у здорових донорів. Одержані моно- і
поліклональні антитіла проти рекомбінантного фрагмента Кі-67, які можна
використовувати в імуногістохімічних дослідженнях.

Особистий внесок здобувача. Усі дослідження із створення, скринування
кДНК бібліотек, аналізу одержаних позитивних клонів, гетерологічного
скринування, клонування та очистці Кі-67 і аналізу його здатності
зв’язуватись з ДНК, одержання і характеристиці моно- і поліклональних
антитіл до фрагмента Кі-67 виконано за безпосередної участі здобувача.
Результати із створення кДНК бібліотек і дослідження властивостей
фрагмента Кі-67 отримано у співробітництві з к.б.н., с.н.с. М.В.
Родніним. Моноклональні антитіла проти фрагмента Кі-67 одержували у
співробітництві з к.б.н., с.н.с. Г.В. Овчаренко. Імуногістохімічні
дослідження здійснено у співробітництві з к.б.н. В.В. Лізогубовим. Автор
вдячний к.м.н., с.н.с. І.Т. Гуту за корисні поради і зауваження під час
стажування в Людвігівському інституті дослідження раку (Лондон, Велика
Британія). Здобувач висловлює щиру подяку своєму першому науковому
керівникові академіку НАН України Г.Х.Мацуці.

Автор вдячний науковому керівнику –завідувачу відділу структури та
функцій нуклеїнових кислот д.б.н., с.н.с. В.В. Філоненку за поради при
проведенні аналізу і обговоренні результатів. Одержані результати
опубліковано в спільних працях.

Апробація результатів дисертації. Основні положення дисертації
представлено на 3-й і 5-й Міжнародній Парнасівській конференціях
”Mechanisms of cellular signal transduction and communication” (Львів,
2000; Київ, 2005); Конференції молодих науковців і аспірантів з генетики
(Львів, 2000); 2-му З’їзді онкологів країн СНД (Київ, 2000); Конференції
молодих науковців, аспірантів і студентів з молекулярної біології і
генетики, присвяченій відкриттю Українського молекулярно-біологічного
товариства (Київ, 2001); XIV Зимовій міжнародній молодіжній науковій
школі „Перспективные направления физико-химической биологии и
биотехнологии” (Москва, 2002); 6-й Школі Джона Хампфрi з імунології
„Molecular basis of the immune response” (Пущіно, 2002); Міжнародній
науковій конференції „Современное состояние проблем и достижений в
области генетики и селекции” (Астана, 2002); VIII Українському
біохімічному з’їзді (Чернівці, 2002); Установчому з’їзді товариства
клітинної біології (Львів, 2004) та Конференції молодих онкологів (Київ,
2006).

Публікації. За темою дисертації опубліковано 21 наукову працю, із них 6
експериментальних статей у співавторстві у фахових наукових журналах та
тези 15 доповідей у збірниках матеріалів міжнародних та всеукраїнських
наукових конференцій.

Структура та обсяг роботи. Дисертація складається із вступу, огляду
літератури, матеріалів і методів дослідження, експериментальної частини,
узагальнення одержаних результатів, висновків, переліку цитованої
літератури, який охоплює 223 найменувань і додатку. Дисертацію викладено
на 157 сторінках машинописного тексту, вона містить 23 рисунки та 9
таблиць.

Основний зміст

Матеріали і методи дослідження. Для створення кДНК експресуючих
бібліотек використано чотири зразки карциноми щитовидної залози людини
та одну біопсію меланоми. Три зразки папілярної карциноми щитовидної
залози були люб’язно надані д.мед.н., проф. В.О. Малижевим (Український
науково-практичний центр ендокринної хірургії, трансплантації
ендокринних органів та тканин, Київ) та один фрагмент фолікулярної
карциноми- морфологічною лабораторією БІОНТЕК (Дніпропетровськ), зразок
меланоми –д.б.н., проф. Б.Т. Білинським (Львівський медичний інститут).

Після видалення пухлини і до початку виділення РНК тканини зберігали в
рідкому азоті. Для виділення препаратів сумарної РНК використано
гуанідин-ізотіоціанатний метод. мРНК одержували афінною хроматографією
на оліго (dT) носії Dynabeads (Dynal, Велика Британія). кДНК бібліотеку
створювали з використанням набору реактивів фірми Stratagene (США) за
рекомендованою ними методикою. Як вектор для клонування використано ДНК
фага л UniZap (Stratagene, США) або TriplEx (Clontech, США). Підготовка
сироваток для ауто — та гетерологічного скринування полягала в афінному
очищенні від антитіл проти білків E.coli і фага л на носіях, з якими
були ковалентно зв’язані бактеріальні та фагові білки (Y1090 і BNN97,
5-3Prime, США). Для скринування кДНК бібліотек сироватки розводили у
співвідношенні 1:(100-200) у буфері TBS (0,1 M трис-HCl, pH 7,7, 0,15 M
NaCl ) та зберігали за температури 4оС з додаванням 0,02 % NaN3 .

Скринування експресуючих кДНК бібліотек. Для первинного скринування кДНК
бібліотек клітини E. coli штаму XL-1 MRF- інфікували рекомбінантними
фагами і висівали на чашки Петрі (150 мм) в концентрації (6-8)·103
фагових частинок на чашку. Експресію рекомбінантних білків у фагових
бляшках індукували додаванням 1 мМ IPTG, синтез білків проходив протягом
ночі. Для перенесення експресованих білків з поверхні агарози на
нітроцелюлозну мембрану використовували стандартну методику пасивного
перенесення. Для ідентифікації клонів, які експресують IgG людини,
фільтри інкубували з антитілами проти IgG людини, міченими пероксидазою
хрону (HRP) у розведенні 1:1000 (Sigma, США) та барвника DAB за
стандартною методикою. Виявлені клони відмічали і не враховували в
подальших дослідженнях. Далі ті ж самі фільтри інкубували з афінно
очищеною сироваткою крові хворого у розведенні 1:100. Імунореактивні
клони виявляли за допомогою антитіл проти IgG людини, мічених лужною
фосфатазою, та барвників NBT/BCIP. Для підтвердження того, що відібрані
клони є позитивними, проводили вторинний скринінг на 10 см чашках Петрі
за такою ж методикою.

Рекомбінантні ДНК з позитивних фагових клонів конвертували у плазміду
pBlueScript методом рекомбінації in vivo в клітинах E. coli штаму SOLR.

Аналіз позитивних клонів. Розміри вставок кДНК позитивних клонів
визначали рестрикційним аналізом або ПЛР. Продукти рестрикції або
ампліфікації аналізували електрофорезом в 1 % агарозному гелі.
Визначення первинних послідовностей рекомбінантних ДНК здійснювали за
допомогою ПЛР та автоматичного секвенатора ABI 373. Для ідентифікації
клонів і їхнього аналізу використовували електронні бази даних EMBO,
GenBank, Blast.

Клонування фрагмента Ki-67 антигену. Фрагмент кДНК Кі-67 розміром 435
п.н. ампліфікували за допомогою ПЛР. Як сенсовий праймер використовували
олігонуклеотидну послідовність ATTGCTAGCCACCACCACCACCACCACAAACT
GGACCCAGCAGCAAGTGTAAC, яка містила сайт рестрикції ендонуклеази NheІ і,
безпосередньо за ініціюючим метіоніном, послідовність, яка кодує шість
залишків гістидинів і дев’ять а.з. Кі-67. Антисенсовий праймер
CGGGAATTCCTATAG AGCCTCAGCCTTTTCCTTAGG містив сайт розпізнавання для
рестриктази EcoR1, стоп-кодон і 9 а.з Кі-67. Ампліфікований фрагмент
кДНК клонували в експресуючий бактеріальний вектор pET23d (Novagene,
США) за відповідними сайтами. Синтез білка у клітинах E.coli BL21DE3LysS
індукували 1 мМ IPTG, після чого клітини вирощували при 30оС протягом
4-5 годин. Рекомбінантний фрагмент білка виділяли афінною хроматографією
на носії Ni-NTA сефарозі (Quiagen, США).

Для гетерологічного скринування використовували три методики:

До клітин E.coli, культивованих у рідкому 2YT середовищі до ОД600= 0,5,
додавали рекомбінантні бактеріофаги, які містили послідовності
позитивних клонів, та інкубували при 420С до повного лізису клітин.
Одержані лізати використовували як антиген. Рівнень антитіл у сироватках
досліджували методом дот-блот аналізу з використанням афінно очищених
сироваток крові та антитіл проти Fc-фрагмента IgG людини, мічених
пероксидазою хрону (HRP), у розведенні 1:1000 (Sigma, США), та барвника
DAB за стандартною методикою.

Стоки бактеріофагів, які містили кДНК імуногенних фрагментів, у
концентрації 100 колонієутворюючих частинок на дослід, розносили на
поверхню верхнього агару, який містив клітини E. coli XL-1 Blue MRF-, у
вигляді дискретних плям. Коли з’являлися зони лізису до поверхні чашок
Петрі прикладали нітроцелюлозний фільтр, який, після 12 годинного
пасивного перенесення білків, використовували для визначення сироваток,
які містили аутоантитіла проти певних клонів за методикою, використаною
для скринування бібліотек.

Для кількісного аналізу рівня аутоантитіл у сироватках крові хворих і
практично здорових донорів проти Кі-67 використовували ELISA за
стандартним протоколом. Візуалізували реакцією за допомогою вторинних
антитіл проти IgG людини, міченими з HRP у розведенні 1:5000 (Sigma,
США), та барвника АBTS.

Моно- і поліклональні антитіла одержували за стандартною методикою.
Позитивні клони відбирали методами ELISA і Вестерн-блота, як антиген
використовли рекомбінантний фрагмент Ki-67.

Результати досліджень та їх обговорення.

Суть методу SEREX полягає у скринуванні кДНК бібліотеки, яку створюють
із тканини пухлини, аутологічною сироваткою крові хворого. Схематично
цей метод наведено на рис. 1.

Рис. 1. Основні етапи ідентифікації пухлиноасоційованих антигенів
методом SEREX

Для одержання репрезентативних кДНК бібліотек використано
гуанідин-ізотіоцианатний метод. Нативність РНК перевіряли електрофорезом
у формальдегід-агарозному гелі. Для одержання препаратів сумарної РНК і
мРНК використано зразки тканин пухлин масою 300-400 мг. Вихід сумарної
РНК складав 5-10 мг, а мРНК — 5-10 мкг, що є достатнім для створення
експресуючої кДНК бібліотеки. Співвідношення А260/280 для одержаних
препаратів РНК становило близько 2, що свідчило про відсутність у них
білкових забруднень.

Створено чотири кДНК бібліотеки раку щитовидної залози та одну —
меланоми шкіри людини. У табл. 1 наведено характеристики одержаних
бібліотек.

Таблиця 1

Основні характеристики використаних у роботі кДНК бібліотек

Бібліотека/ діагноз Розмір бібліоте-ки, pfu Кількість клонів IgG

на 8000 pfu Кількість позитив-них клонів

Mel 1/ меланома шкіри з високим мітотичним потенціалом 1,2 · 106 ~100 10

Thy 1/ папілярна аденокарцинома ЩЗ 1,6 · 106 ~ 2 3

Thy 2/ недиференційована аденокарцинома ЩЗ 1,4 · 106 ~17 12

Thy 3 / фолікулярна карцинома ЩЗ 3 · 106 ~9 15

Thy 4 папілярна карцинома ЩЗ 1 · 106 ~ 6 15

Фрагменти кДНК клонували з використанням двох векторів: TriplEx для
створення бібліотек Mel, Thy1, Thy2 і Unizap — для Thy3, Тhy4. Титр
одержаних бібліотек становив (1-3)·106 pfu, кількість нерекомбінантних
фагів, яку визначали за результатами біло–блакитної селекції у
присутності IPTG та X-Gal, не перевищувала 2 %. Таким чином, одержані
бібліотеки були придатними для скринування.

Попереднє скринування кДНК бібліотек для елімінації клонів, які кодують
імуноглобуліни людини, здійснювали методом Вестерн-блот з використанням
мишачих антитіл проти Fc-фрагмента імуноглобуліну людини, кон’югованих з
пероксидазою хрону, та барвника DAB за стандартною методикою. Коли
з’являлися фагові бляшки, експресовані білки переносили на
нітроцелюлозні фільтри, які після блокування 5 % молоком інкубували з
кон’югатом. Бляшки, що експресують IgG, візуалізували методом посиленої
хемілюмінесценції. Клони імуноглобуліни відмічали і не враховували при
подальшому скринуванні. Слід зазначити, що, незважаючи на це, біля 10 %
клонів імуноглобулінів не було виявлено. Дійсно позитивні клони
ідентифікували після інкубації фільтрів з аутологічною сироваткою крові
за допомогою антитіл до Fc-IgG людини, кон’югованих з лужною фосфатазою,
та барвників NBT і BCIP за стандартною методикою.

Після ідентифікації первинно позитивних клонів проводили вторинне
скринування, під час якого виділяли гомогенні клони первинно позитивних
фагів та елімінували псевдопозитивні. Загалом, при аутологічному
скринуванні бібліотеки з меланоми одержано 10 позитивних клонів, які є
фрагментами чотирьох генів (табл. 2). Першим ідентифікованим антигеном
був репресорний білок D 30612. Про нього в літературі є небагато даних.
Відомо, що він репресує вірус лейкемії людини типу 1. Показано, що цей
білок складається з 671 а.з. має п’ять „цинкових пальців”. Його мРНК
експресована в усіх видах тканин. Чотири клони представляли різні
фрагменти білка центромери CENP-B. У літературі існує багато
Таблиця 2

Пухлиноасоційовані антигени, виявлені при імуноскринуванні кДНК
бібліотеки з меланоми шкіри людини

№ групи Ідентичність / гомологія Кількість клонів

М-1 Репресорний білок D 30612 1

М-2 Білок теплового шоку 105 кДa/110 kDa 1

М-3 CENP-B аутоантиген центромери 4

М-4 Кі-67 ядерний антиген 4

даних про наявність антитіл проти цього білка при різних аутоімунних
порушеннях проте знайдено лише одну роботу щодо гіперекспресії CENP-B у
первинних злоякісних пухлинах товстого кишечнику.

кДНК чотирьох клонів кодували різні фрагменти ядерного антигену Ki-67.
Цей білок з’являється в ядрі клітини наприкінці G1 фази клітинного
циклу. Його кількість досягає максимуму в мітозі, після чого антиген
швидко деградує (або втрачає антигенну детермінанту). Період його
напівжиття становить менше 1 год. Антитіла проти Кі-67 використовують
для встановлення мітотичного індексу трансформованих клітин. Особливістю
структури Кі-67 є центральна частина (13-й екзон), яка містить 16
тандемних повторів по 122 а.з. із ступенем гомології 70 %. Можлива роль
Кі-67 у клітині — це зв’язування з хроматином, що може відігравати певну
роль у процесі поділу клітин. На користь цього свідчать дані щодо
високої основності білка. Ідентифіковані нами фрагменти ядерного
антигену відповідали фрагментам 13-го екзону і містили частини 12-го та
13-го повторів.

При імуноскринуванні чотирьох бібліотек з пухлин щитовидної залози
ідентифіковано 45 клонів, кДНК яких кодували фрагменти 29 різних генів
(табл. 3).

Аналіз ідентифікованих антигенів з урахуванням особливостей
неопластичної клітини показав їхню участь у багатьох метаболічних
процесах клітини і, зокрема, у тих, які є критичними для злоякісної
трансформації. Так, ДНК першого позитивного клону кодувала фрагмент
фактора, який асоційований з TATA-зв’язувальним білком TBP. Раніше його
було виявлено методом SEREX у клітинах карциноми нирок. Цей білок бере
участь у регуляції транскрипції, опосередкованої ТАТА-блоком. Чотири
клони кодували ділянки гена — кінектину. Даний білок є рецептором
кінезину і бере участь у забезпеченні функціональної активності
мікротрубочок. Білок виявлено й іншими групами, які використовують метод
SEREX, у пухлинах шлунка, молочної залози, семіномі та при лімфомі
Ходжкіна. (-Катенін раніше було ідентифіковано як аутоантиген при
меланомі, раку нирок, молочної залози, товстого кишечнику та сім’яників.
(- і (-катеніни беруть участь в опосередкованій кадерином клітинній
адгезії. Порушення функцій (- та (-катенінів пов’язують з інвазійним
потенціалом злоякісно трансформованих клітин. У багатьох злоякісних
пухлинах спостерігається підвищена експресія протеаз. кДНК клону Т-26
кодує протеазу — катепсин Н, про яку відомо, що її експресія
підвищується при неоплазіях простати. Колаген типу VIII було виявлено як
антиген при розвитку гемангіоми. Деякі білки рибосом ідентифіковано
іншими дослідниками як ПАА. У даному дослідженні ідентифікова-

Таблиця 3

Пухлиноасоційовані антигени, виявлені при імуноскринуванні чотирьох кДНК
бібліотек із щитовидної залози

№ біб-ліотеки № групи Ідентичність / гомологія Кількість клонів

Thy 1 Т-1 TBP – зв’язувальний фактор 1

Т-2 Ліпокортин II 1

Т-3 Тироглобулін 1

Thy 2 Т-4 Кінектин, рецептор кінезину 4

Т-5 KIAA1327 білок (Homo sapiens) 1

Т-6 АТР-аза, мітохондріальна 1

Т-7 Тимозин в 4 1

Т-8 CDC42 зв’язувальна кіназа бета (DMPK-подібна) 1

Т-9 Кисла церамідаза 1

Т-10 Частина хромосоми18, клон RP11-15F12 (Homo sapiens) 1

Т-11 мРНК KIAA1735 білка (Homo sapiens) 1

Т-12 Частина хромосоми 17 BAC GS1-531I17 (Homo sapiens) 1

Thy 3 Т-13 Білок, подібний до бета катеніну 1 5

Т-14 Білок, який містить цинковий палець C2H2 (NZF) 2

Т-15 Альфа катенін 2

Т-16 12 BAC RP11-686G8 (Homo sapiens) 1

Т-17 Nmc білок 1

Т-18 Аутоантиген апарату Гольджі, гольджин 1

Т-19 TOB2 1

Т-20 Антиген, асоційований із солідними пухлинами 1

Thy 4 Т-21 мРНК Musashi гомолог 2 (Drosophila) 2

Т-22 Рибосомний білок S24 (RPS24) 2

Т-23 Малий ядерний рибонуклеопротеїд, поліпептид G 2

Т-24 Секвестосома 1 1

Т-25 Несаркомерний міозин, легкий ланцюг 3

Т-26 Катепсин H 1

Т-27 Білкова фосфатаза 1, регуляторна субодиниця 15A 1

Т-28 Колаген, тип VIII, альфа 2 1

Т-29 Клон XXbac-44E15 хромосоми 6 (Homo sapiens) 2

но рибосомний білок S24. Три клони кодували несаркомерний легкий ланцюг
міозину (Т-25). Також серед SEREX–клонів нами було ідентифіковано CDC42
протеїнкіназу (Т-8), фосфорилювання якою таких ланцюгів призводить до
активації актин-міозинового скорочення. У той же час зміна регуляції
актин-міозинових скорочень, індукована порушенням сигнальних шляхів,
може відігравати суттєву роль в інвазивності злоякісних пухлин та
метастазуванні. Можливу роль виявлених антигенів у функціонуванні
неопластичної клітини показано на рис. 2.

Рис. 2. Основні властивості неопластичної клітини

Незважаючи те, що методом SEREX ідентифіковано більше 2600 антигенів,
лише невелика частина з них використовується для діагностики або терапії
онкологічних захворювань. Тому суттєвою характеристикою одержаних клонів
є гетерологічне скринування — визначення їхньої імунореактивності з
використанням сироваток крові практично здорових донорів та хворих на
різні онкологічні захворювання. У роботі використано три типи
гетерологічного скринування. Перший тип гетерологічного скринування
(табл. 4), у якому як антиген використано

Таблиця 4

Рівень імунної відповіді сироваток хворих на рак прямої кишки (РПК),
легень (РЛ), молочної залози (РМЗ) та товстого кишечнику (РТК) проти
антигенів, ідентифікованих з бібліотек щитовидної залози

Клони/група РПК РЛ РМЗ РТК

KY-Thy1/ Т-1 1,07 0,19 0,88 1,68

KY-Thy 2/ Т-2 0,69 0,71 0,26 0,76

KY-Thy 3/ Т-3 0,47 0,44 0,19 0,72

KY-Thy 4/ Т-4 0,61 0,59 0,42 0,72

KY-Thy 5/ Т-5 1,2 1,35 0,24 1,02

KY-Thy 6/ Т-6 1,55 1,7 1,41 1,61

KY-Thy 7/ Т-4 1,21 1,19 0,83 1,41

KY-Thy 8/ Т-4 0,91 1,12 0,3 1,2

KY-Thy 9/ Т-7 0,59 0,68 0,73 1,21

KY-Thy 10/ Т-4 -0,2 0,18 -0,2 0,25

KY-Thy 11/ Т-8 0,47 0,36 0,23 0,72

KY-Thy 12/ Т-9 1,01 0,92 0,87 1,12

KY-Thy 13/ Т-10 -0,24 -0,02 -0,48 -0,01

KY-Thy 14/ Т-11 0,92 0,73 0,64 1,14

KY-Thy 15/ Т-12 1,09 1,03 0,7 1,16

лізати клітин E. сoli, інфікованих відповідними рекомбінантними фагами,
а оцінку рівня імунної відповіді проводили в умовних одиницях від 1
(практична відсутність відповіді, еквівалентна лізату E. сoli
нерекомбінантним фагом, до 4 (відповідь, еквівалентна позитивному
контролю), дозволив встановити ПАА. Результати його для 10 клонів з
меланоми у табл. 5. Таким чином, результати гетерологічного скри-

Таблиця 5

Рівень імунної відповіді сироваток хворих на рак прямої кишки (РПК),
легень (РЛ), молочної залози (РМЗ) та товстого кишечнику (РТК) проти
антигенів, ідентифікованих в бібліотеці меланоми

клони/група РПК РЛ РМЗ РТК

KY-Mel1/ М-1 1,37 1,11 0,9 1,35

KY-Mel 2/ М-2 1,16 0,76 0,73 1,3

KY-Mel 3/ М-3 0,32 0,21 0,47 0,81

KY-Mel 4/ М-4 1,37 1,49 1,09 1,44

KY-Mel 5/ М-3 0,19 0,52 0,19 0,54

KY-Mel 6/ М-3 0,6 1,22 0,6 0,6

KY-Mel 7/ М-3 -0,1 0,05 -0,48 -0,47

KY-Mel 8/ М-4 1,42 1,54 0,76 1,41

KY-Mel 9/ М-4 1,07 1,12 0,54 1,41

KY-Mel 10 М-4 1,36 1,73 1,17 1,41

нування дали можливість окреслити коло антигенів, які є перспективними
для використання в діагностиці та терапії новоутворень. Зокрема, рівень
аутоантитіл проти фрагментів репресорного білку, антигену Кі-67,
мітохондриальної АТР-ази був підвищений в сироватках крові хворих на рак
усіх досліджених типів.

. d f ¤ a E

?

f ¤ a 6

R

E

E

„@

^„@

&

F

&

F

??

??

??

??

??

??

????

??

????

•kdA

???????

??

, білок експресовано в бактерійній системі експресії і афінно очищено на
металовмісних носіях (рис. 3).

Рис. 3. Електрофореграма афінного очищення на Talon-сефарозі
рекомбінантного фрагмента білка Кі-67 з лізатів бактеріальних клітин
BL23DE3, трансформованих вектором рЕТ23d/HisMel9:

1 — очищений рекомбінантний білок;

2 – клітинний лізат після індукції синтезу білка ІПТГ;

3 — маркери молекулярної маси

1 2 3

Для ELISA використовували рекомбінантний фрагмент Кі-67 та сироватки
онкологічних хворих і практично здорових донорів, які аналізували в
першому гетерологічному скринуванні. Згідно з даними, наведеними в табл.
6, імунореактивність сироваток пацієнтів з раком легень та молочної
залози проти фрагмента Кі-67 є достовірно вищою, ніж у здорових донорів.

Таблиця 6

Рівень аутоантитіл проти рекомбінантного фрагмента антигену Кі-67 в
сироватках крові практично здорових донорів (норма), хворих на рак
легенів (РЛ), молочної залози (РМЗ), товстого кишечнику (РТК), та прямої
кишки (РПК)

Норма (n=9) РЛ (n=13) РМЗ (n=21) РТК (n=11) РПК (n=7)

OD405 0,215(0,025 0,392(0,042* 0,463(0,096* 0,182(0,066 0,303(0,095

* рівень достовірності р?0,05

Оскільки для ELISA використовували хроматографічно очищений фрагмент
Кі-67, то попереднє виснаження сироваток крові не було потрібне. Це
дозволило проаналізувати широку вибірку сироваток хворих на онкологічні
захворювання різної етіології та практично здорових донорів (рис. 4).

З наведених результатів видно, що в усіх досліджуваних групах, за
винятком раку яєчників, рівень імунної відповіді певного відсотка
вибірки перевищував норму. Антитілопозитивними вважали сироватки, рівень
імунної відповіді у яких перевищував середньостатистичне значення
контрольної групи на три стандартних відхилення.

Проаналізувавши первинну послідовність фрагмента Кі-67, було виявлено 35
%-ву гомологію з екзонуклеазою 5 г-субодиниці Pseudomonas syringae. Щоб
перевірити, чи має даний фрагмент нуклеазну активністю, лінеарізовану і
нативну плазмідну ДНК інкубували з рекомбінантним фрагментом Кі-67. Як
видно з даних наведених на рис. 5, нуклеазну активнисть не
спостерігали, проте можна вказати на

Рис. 5. Аналіз взаємодії рекомбінантного фрагмента Кі-67 з плазмідною
ДНК, проведений методом електрофорезу в агарозному гелі:

1 — 10 нг плазміди рET23d (лінерізована EcoRI) з Кі-67;

2 — 10 нг плазміди рET23d(лінерізована EcoRI);

3 — маркери молекулярної маси 1 kB Gene rule;

4 — 10 нг плазміди рET23d (нативна);

5 — 10 нг плазміди рET23d (нативна) з Кі-67

1 2 3 4 5

втрату рухливості плазміди, яку можна пояснити екрануванням негативного
заряду плазміди молекулами Кі-67 при зв’язуванні з ДНК. В іншому
експерименті при інкубації зростаючих кількостей фрагмента Кі-67 з
плазмідною ДНК спостерігали уповільнення руху плазміди в агарозному
гелі. При молекулярному співвідношенні білок:ДНК — 150:1 плазміда
повністю втрачала рухливість.

Літературні дані про взаємодію ядерного антигену Кі-67 з хроматином
спонукали перевірити чи взаємодіятиме фрагмент Кі-67 з ДНК про- і
еукаріотичного походження. Ефективність зв’язування Кі-67 з
еукаріотичною ДНК була вищою, ніж з прокаріотичною. У контрольному
експерименті з білком pIX аденовірусу 2-го серотипу, який також містив
гістидинову послідовність, ніякої взаємодії не спостерігали (рис.6).

Рис. 6. Взаємодія ДНК про- і еукаріотичного походження з білками, які
містили полігістидинову послідовність. На нітроцелюлозній мембрані
іммобілізували ДНК, далі фільтр інкубували з 100 мкг Кі-67/His або
pIX/His і унаочнювали реакцією з моноклональними антитілами проти
гістидинової мітки за допомогою ECL:

А- блот, інкубований з рекомбінантним фрагментом Кі-67 антигену;

Б- блот, інкубований з pIX білком аденовірусу;

1-5 кількість ДНК (100, 200, 300, 400, 500 мкг відповідно)

Беручи до уваги відомі з літератури і одержані нами дані щодо Кі-67
антигену, наступним етапом дослідження стало одержання полі- та
моноклональних антитіл проти фрагмента Кі-67 для вивчення особливостей
його локалізації у клітинах пухлин різного гістогенезу. Одержано шість
моноклональних антитіл проти рекомбінантного фрагмента Кі-67, п’ять із
яких розпізнавали його в денатурувальних умовах (рис. 7).

Рис. 7. Результати Вестерн-блот аналізу К-середовищ різних клонів
гібридомних клітин, що продукують антитіла проти Кі-67. Як антиген
використовували рекомбінантний фрагмент антигену Кі-67: 1-6 —
К-середовища різних клонів

При вивченні специфічності одержаних моноклональних антитіл було
проведено дослідження препаратів кріостатних зрізів сім’яних канальців
людини. На рис. 8 показано, що ядерний антиген Кі-67 детектується в зоні
зовнішньої базальної мембрани статевих тяжів. Можна припустити, що
антитіла взаємодіють з антигеном, що експресується у сперматогоніях, які
є, як відомо, високопроліферуючими клітинами.

При дослідженні субклітинної локалізації антигену Кі-67 у злоякісних
пухлинах аденокарциноми молочної залози людини виявили, що антитіла лише
з двох клонів (Ki-67-1 і Ki-67-6) здатні розпізнавати Кі-67 в умовах
гістохімічного аналізу на парафінових зрізах, що надає їм перевагу
порівняно з комерційними аналогами. Позитивне забарвлення спостерігали
на стадіях S, у профазі та метафазі, воно відсутнє в анафазі та телофазі
клітинного циклу (рис. 9).

ref SHAPE \* MERGEFORMAT

Як видно з рис. 9, під час профази Кі-67 детектується в периплазматичній
частині ядра, що може бути пов’язано з активним експортом білка в ядро.
В метафазі забарвлення спостерігали в ділянці метафазної пластинки, а
протягом анафази та телофази забарвлення зникає, що може бути
результатом або деградації білка, на користь чого свідчать дані
літератури про короткий період напівжиття білка (до 1,5 год), або втрати
ним антигенної детермінанти, з якою взаємодіють одержані нами антитіла.
Таким чином, дані антитіла можуть бути використані для визначення
особливостей функціонування Кі-67 під час поділу клітини.

Висновки

У дисертації методом SEREX вперше було досліджено антигени, асоційовані
з раком щитовидної залози та меланоми людини, які викликають появу
аутоантитіл у сироватках крові онкологічних хворих. Досліджено
структурно-функціональні особливості найбільш імунореактивного з них
–фрагмента ядерного антигену Кі-67.

З тканин раку щитовидної залози людини та меланоми створено п`ять кДНК
експресуючих бібліотек з титром (1,2 — 3)·106 колонієутворюючих одиниць.

При імуноскринуванні одержаних бібліотек ідентифіковано 55 клонів, проти
яких в аутологічних сироватках крові хворих було виявлено антитіла. При
секвенуванні кДНК одержаних клонів встановлено, що вони є фрагментами 33
генів, 7 з яких раніше ідентифіковано методом SEREX.

При гетерологічному скринуванні показано, що рівень аутоантитіл проти
Кі-67 антигену, репресорного білка та АТР-ази підвищений у хворих при
всіх досліджених видах раку, що дає змогу розглядати їх як потенційні
маркери злоякісного росту.

Одержано у гомогенному стані рекомбінантний фрагмент антигену Кі-67 і
показано, що рівень антитіл проти нього є достовірно вищим у сироватках
крові хворих на меланому, рак щитовидної залози, молочної залози та
легенів порівняно із здоровими донорами.

Показано, що рекомбінантний фрагмент Кі-67 антигену здатний взаємодіяти
з ДНК про- та еукаріотичного походження в умовах in vitro.

Одержані моно- та поліклональні антитіла проти рекомбінантного фрагмента
Кі-67. Моноклональні антитіла Кі-67-1 і Кі-67-2 можна використовувати як
маркер S-фази, профази та метафази клітинного циклу або для визначення
мітотичного індексу тканин.

Перелік наукових праць, опублікованих за темою дисертації

Роднин Н.В., Тихонкова И.А., Немазаный И.А., Горлова Л.Н., Комисаренко
И. В., Пальчевский С.С., Кухаренко А.П., Дробот Л. Б., Мацука Г.Х.,
Филоненко В.В., Гут И.Т. Серологическая идентификация антигенов,
вызывающих аутоиммунную реакцию при раке щитовидной железы человека//
Експериментальна онкологія.- 2000.- Т. 22, №3. — C.135-138. Особистий
внесок: створення та скринінг кДНК бібліотек раку щитовидної залози,
підготовка статті до друку.

Роднін М.В., Тихонкова І.О., Філоненко В. В., Дробот Л.Б. Мацука Г.Х.,
Гут І.Т. Пошук та характеристика антигенів меланоми за допомогою методу
SEREX// Біополімери і клітина.- 2000.- T. 16, №5. -C. 339-344. Особистий
внесок: створення та скринінг кДНК бібліотеки меланоми, клонування,
очистка Кі-67, гетерологічний скринінг, підготовка статті до друку.

Rodnin N.V., Tykhonkova I.O., Kyyamova R.G., Garifulin O.M., Gout I.T.,
Filonenko V.V. Identifivation of tumor-associated antigens in human
thyroid papillar carcinoma// Біополімери і клітина.- 2003.- T. 19, №6.-
C. 541-548. Особистий внесок: створення та скринінг кДНК бібліотеки раку
щитовидної залози, підготовка статті до друку.

Кіямова Р.Г., Роднін М.В., Гаріфулін О.М., Тихонкова І.О., Корольова
К.П., Малець М.С., Гут І.Т., Філоненко В.В. Алогенний скринінг пухлинних
антигенів з кДНК бібліотек раку щитовидної залози// Біополімери і
клітина-2004.- Т. 20, №1-2.- С. 151-157. Особистий внесок: скринінг кДНК
бібліотеки раку щитовидної залози, секвенування та ідентифікація
позитивних клонів.

Тихонкова І.О., Лізогубов В.В., Хожаєнко Ю.В., Довгопола О.О., Коровін
С.І., Овчаренко Г.В., Усенко В.С., Роднін М.В., Філоненко В.В.
Дослідження структурно-функціональних властивостей імуногенного
фрагмента Кі-67 антигену та отримання проти нього полі- та
моноклональних антитіл// Біополімери і клітина.- 2005.- Т 21, №2.- С.
180-183. Особистий внесок: очистка рекомбінантного фрагмента Кі-67,
дослідження його зв’язувальної активності, одержання полі- та
характеристика моноклональних антитіл, підготовка статті до друку.

Lyzogubov V., Khozhaenko Y., Usenko V., Antonjuk S., Ovcharenko G.,
Tikhonkova I., Filonenko V. Immunohistochemical analysis of Ki-67, PCNA
and S6K1/2 expression in human breast cancer// Experimental oncology.-
2005.- Vоl. 27, № 2.- P 141-144. Особистий внесок: характеристика
моноклональних антитіл.

Tykhonkova I.O. Identification of tumor associated antigens in thyroid
cancer by SEREX methodology// Conference on Genetics & Molecular Biology
for Students & Young Scientists devoted to 100th anniversary of
genetics.- Львів (Україна).- 2000.- Р. 27. Особистий внесок:
характеристика позитивних клонів з тироїдної кДНК бібліотеки підготовка
тез, виступ на конференції.

Тихонкова I.O. Пошук та характеристика антигенів меланоми методом
SEREX// Укр. біохім. журн.- 2000.-Т. 72, № 6.- С.142. Особистий внесок:
клонування Кі-67, гетерологічний скринінг, підготовка тез, виступ на
конференції.

Rodnin N.V., Tykhonkova I.A., Filonenko V.V., Gout I.T., Matsuka G. Kh.
Serological identification of autoimmune reactive antigens at human
thyroid cance & melanoma // 2nd Сongress of oncologists of the CIS
countries Kyiv (Ukraine) .- Experimental Oncology.- 2000.- Vol. 22, №
3.- Р.165. Особистий внесок: гетерологічне скринування позитивних
клонів.

Filonenko V.V., Tykhonkova I.O., Rodnin N.V., Drobot L.B., Gout I.T.,
Matsuka G. Kh. Serological identification of tumor-associated antigens
at human thyroid cancer & melanoma// 3rd Parnas Conference Mechanisms of
cellular signal transduction and communication.- Lviv (Ukraine).- 2000.-
Р. 61. Особистий внесок: характеристика позитивних клонів.

Filonenko V.V., Rodnin N.V., Tykhonkova I.A., Kiyamova R.G., Garifulin
O.M., Usenko V.S., Lyzogubov V.V., Gout I.T. Identification of
tumor-associated antigens by SEREX methodology//International Symposium
Intracellular signaling in plant and animal systems.- Kyiv (Ukraine).-
2001.- Р. 60. Особистий внесок: порівняння даних одержаних при скринінгу
бібліотек з раку щитовидної залози і меланоми.

Tykhonkova I.A., Rodnin N. V., Filonenko V. V., Gout I. T.
Identification of tumor-associated antigens by SEREX methodology//
Conference for students, PhD students and young scientists on molecular
biology and genetics dedicated to the establishment of Ukrainian Society
for molecular biology.- Kyiv (Ukraine).- 2001.- Р.172. Особистий
внесок:скринування бібліотек, характеристика клонів, підготовка тез ,
виступ на конференції.

Тихонкова И.А., Роднин Н.В., Гут И.Т., Филоненко В.В. Идентификация
опухоле-ассоциированых антигенов рака щитовидной железы человека методом
SEREX // XIV Зимняя международная молодежная научная школа
“Перспективные направления физико-химической биологии и биотехнологии”.-
Москва (Россия) .- 2002.- С. 21. Особистий внесок: секвенування
позитивних клонів.

Tykhonkova I.A., Rodnin V.V., Filonenko V.V., Gout I.T. Identification
of tumor-associated antigens by SEREX methodology // 6th John Humphrey
advanced summer programme in immunology.- Pushchino (Russia).- 2002.- Р.
140. Особистий внесок: скринування бібліотек, підготовка тез, виступ на
конференції.

Kyjamova R., Garrifulin O., Rodnin N., Tykhonkova I., Usenko V.,
Lysogubov V., Pogrebnoy P., Kikot V., Filonenko V., Gout I., Matsuka G.
Identification of colon and thyroid tumor antigens// Укр. біохім. журн.-
Т. 74 спеціальний випуск Матерали VIII Українського біохімічного з’їзду
Чернівці (Україна).-№ 4б (додаток 2).- 2002.- С.36. Особистий внесок:
вторинний скринінг, секвенування клонів, порівняння послідовностей з
електронними базами даних.

Тихонкова И.А., Роднин Н.В., Филоненко В.В. Поиск опухолеассоциированых
антигенов при раке щитовидной железы человека методом SEREX //
Международная научная конференция «Современное состояние проблем и
достижений в области генетики и селекции».- 2003.- Алматы (Казахстан).-
С.167-168. Особистий внесок: характеристика найперспективніших клонів.

Tykhonkova I.O., Rodnin M.V., Filonenko V.V. Search and characterization
of the tumor-associated proteins from thyroid papillar carcinoma by
SEREX methodology // Сonference for young scientists, PhD students and
students on molecular biology and genetics, dedicated to the golden
jubilee of the double helix and 30 anniversary of the Institute of
molecular biology and genetics NAS of Ukraine.- Kyiv (Ukraine).-2003.-
Р. 268. Особистий внесок: створення кДНК бібліотеки з папілярної
аденокарциноми.

Kyyamova R., Rodnin M., Garifilin O., Tykhonkova I., Gryshkova V., Gout
I., Filonenko V. Identification of novel tumor-associated antigens with
the use of SEREX-methodology // First (Inaugural) Ukrainian Congress for
Cell Biology. – Lviv (Ukraine). – 2004. P.139. Особистий внесок:
вторинний скринінг імунопозитивних клонів, секвенування їх, порівняння
послідовностей з електронними базами даних.

Tykhonkova I.O., Rodnin M.V., Ovcharenko G.V., Dovgopola O.O., Lizogubov
V.V. Filonenko V.V. The studies of immunological and
structural-functional properties of Ki-67 nuclear antigen fragment//
Укр. біохім. журн.- 2005.- Т. 77, №2 спеціальний випуск.- 5th Parnas
conference molecular mechanisms of cellular signaling.- Р. 248.
Особистий внесок: дослідження ДНК- зв’язувальної активності.

Lyzogubov V., Tytarenko R., Usenko V., Ovcharenko G., Rodnin N.,
Tihonkova I., Filonenko V. Immunohistochemical analysis of S6K1/1
subcellular localization and ribosomal protein S6 phosrhorylation in
human breast cancer // Укр. біохім. журн.- — 2005.- Т. 77, №2
спеціальний випуск.- 5th Parnas conference molecular mechanisms of
cellular signaling. Київ (Україна).-Р. 206. Особистий внесок:
характеристика моноклональних антитіл проти Кі-67.

Тихонкова І.О., Роднін М.В., Довгопола О.А., Коровін С.І., Філоненко
В.В. Характеристика пухлиноасоційованих антигенів раку щитовидної залози
і меланоми ідентифікованих методом SEREX// Всеукраїнська наукова
конференція „Сучасні проблеми експериментальної і клінічної онкології”.-
Київ (Україна).- 2006.- С. 78. Особистий внесок: гетерологічний скринінг
позитивних клонів з раку щитовидної залози.

Анотація

Тихонкова І.О. Пошук і характеристика пухлиноасоційованих антигенів раку
щитовидної залози та меланоми людини.- Рукопис.

Дисертація на здобуття наукового ступеня кандидата біологічних наук за
спеціальністю 03.00.03 – молекулярна біологія. – Інститут молекулярної
біології та генетики НАН України, Київ, 2006.

Ідентифікація пухлиноасоційованих антигенів (ПАА) є важливим напрямком
сучасної онкології і молекулярної біології. Дані антигени можуть бути
використані як для діагностичних, так і терапевтичних цілей.
Найадекватнішим методом ідентифікації ПАА є SEREX, суть якого полягає в
імуноскринінгу кДНК експресуючих бібілотек, одержаних з тканин пухлини,
сироватками крові онкологічних хворих. SEREX використано для
ідентифікації антигенів асоційованих з раком щитовидної залози і
меланомою людини. Ідентифіковано 10 імунореактивних клонів (фрагменти 4
генів) меланоми та 45 клонів (фрагменти 29 генів) раку щитовидної
залози. Гетерологічним скринінгом визначено антигени, проти яких існують
антитіла в сироватках хворих на рак різної етіології. Одними з таких
були фрагменти ядерного антигену Кі-67, білка з невідомою функцією, але
відомого маркера проліферації. Продемонстровано ДНК-зв’язувальну
активність фрагмента Кі-67, що може бути відправною точкою подальших
функціональних досліджень даного білка, а отримані проти нього антитіла
стати основою для визначення мітотичної активності пухлин.

Ключові слова: SEREX, пухлиноасоційовані антигени, рак щитовидної
залози, меланома.

Аннотация

Тихонкова И. А. Поиск и характеристика антигенов ассоциированных c
опухолями рака щитовидной железы и меланомы.- Рукопись.

Диссертация на соискание ученой степени кандидата биологических наук по
специальности 03.00.03 – молекулярная биология.- Институт молекулярной
биологии и генетики НАН Украины, Киев, 2006.

Идентификация опухоль-ассоциированных антигенов (ОАА) является важным
направлением современной онкологии и молекулярной биологии. Эти антигены
могут быть использованы как для диагностических, так и для
терапевтических целей. Метод SEREX является наиболее адекватным для
поиска ОАА, суть его состоит в иммуноскрининге кДНК экспрессирующихся
библиотек, полученных из ткани раковой опухоли, сыворотками крови
онкологических больных. SEREX использовали для идентификации ОАА рака
щитовидной железы и меланомы кожи человека. Идентифицированы 10
иммуноположительных клонов (фрагменты 4 генов) меланомы и 45 клонов
(фрагменты 29 генов) рака щитовидной железы. Гетерологическим скринингом
определены антигены, на которые, в сыворотках крови онкобольных
различной этиологии, присутствовали аутоантитела в высоком титре — в
первую очередь это фрагмент ядерного антигена Кі-67, белка с неизвестной
функцией, но известного как маркер пролиферации. Показана
ДНК-связывающая активность фрагмента Кі-67, что может быть отправной
точкой детальных функциональных исследований данного белка, а полученные
на него антитела — использоваться для определения митотической
активности опухолей.

Ключевые слова: SEREX, опухоль-ассоциированные антигены, рак щитовидной
железы, меланома.

Summary

Tykhonkova I.O. Search and characterization of tumor-associated antigens
from thyroid cancer and melanoma.- Manuscript.

Thesis for Philosophy Doctor (PhD) degree in Biology, speciality
03.00.03 – molecular biology. – Institute of Molecular Biology and
Genetics of National Academy of Sciences of Ukraine, Kyiv, 2006.

Early diagnostics of neoplasia is a prerequisite for successful
treatment of oncological patients but nowadays a repertoire of
diagnostic tools is relatively poor. A certain breakthrow in the
development of such a tools may be found in the field of
immunodiagnostics taking into consideration the fact that the
development of malignancies is often associated with the raise of
autoantibodies directed against tumor antigens. Experimental evidence
from in vitro and in vivo studies has shown that tumor cells are
sufficiently different from normal cells to be recognized and attacked
by the immune system. It is believed that tumors that express unique
antigenic determinants that should be suitable candidates for vaccine
and new diagnostic approaches development. Such tumor-associated
antigens (TAAs) may be expressed on the surface of tumor cells, where
they become targets for the immune system’s humoral response, or they
may be presented by the major histocompatibility complex (MHC) as
peptide fragments and subsequently detected and destroyed by cytotoxic
T-cells. Although there has been a long search for specific antigenic
determinants in cancer, major progress in this field has only been made
possible by using molecular cloning techniques, such as T-cell epitope
cloning, differential display and the SEREX (Serological identification
of antigens by recombinant expression cloning). The SEREX approach for
the search of malignant antigens provocing self-immunization in tumor
patients is mostly adequate and developed for today. In the present
investigation SEREX approach have been used for detection of
tumor-associated antigens in human thyroid cancer and melanoma.

Using the tissues of tumors four cDNA expression libraries from human
thyroid cancer and one from melanoma have been prepared. The main stages
of cDNA library preparation were isolation of mRNA from tumor tissues,
preparation of cDNA using reverse transcription and packing of cDNA
clones in (- derived vectors into bacteriophage ( particles. Recombinant
proteins have been expressed in E. coli XL-1Blue MRF- cells after
infection of bacteriophage. The titers of libraries were about 1-3×106
pfu. The preparation of sera for screening included it’s depletion on
immunosorbents with covalently linked E.coli and wild type phage (
proteins. All the primary immunopositive clones were checked by
secondary and in several cases by tertiary screening. Positive clones
were isolated and converted into plasmid DNA by in vivo excision method
followed by sequencing and identification in common databases. In the
course of autologous screening ten immunopositive clones (fragments of
four genes) have been identified in melanoma and 45 clones (fragments of
29 genes) in thyroid cancer libraries. The clones identified were unique
among all the libraries while some of them have been detected earlier by
other SEREX groups, particularly lipocortin II, kinectin, (-catenin,
KIAA1735, Zn-finger protein and HSP105/110kDa heat-shock protein. The
heterologous screening provided with phage lysates of E.coli cells
induced by IPTG treatment enabled us to detect several antigens with
high percentage of immune responces in cancer sera but low ones in the
sera from healthy donors. Several antigens showed high levels of immune
responses. In the experiment with dot-blotting Ki-67 and protein
containing ATPase domain were the most immunoreactive. Four from ten
positive melanoma clones represented the fragments of Ki-67 nuclear
antigen. The fragment of Ki-67 – the protein with unknown function but
widely used as a marker of proliferation — was considered to be the most
perspective among the antigens for further investigations. It must be
stressed that while overexpression of Ki-67 is common for malignant and
benigh tumors the appearence of autoantibodies against this protein was
detected for the first tume in the present investigation.

For the wide-scale heterologous screening the immunogenic fragment
having size of 145 amino acids containing the part of 12 and 13 Ki-67
repeats of Ki-67 nuclear antigen have been cloned into pET23d plasmid,
expressed in BLDE3LysS cells, purified as His-tagged protein on Talon
resin and used as an antigen in immunochemical investigations.
Large-scale heterologous screening of oncologycal patients sera using
recombinantly expressed and purified immunogenic fragment of Ki-67 by
ELISA revealed a strong immune response in melanoma, thyroid cancer and
breast cancer patients. These results suggest that our recombinant
fragment of Ki-67 nuclear antigen may be used in the development of
tools for early diagnostics of malignanses by screening oncological
patients sera using ELISA method.

The next task was to study the espression and distribution of Ki-67 in
malignant tumor cells and on different stages of cell cycle. For this
purpose mono- and polyclonal antibodies have been raised against
recombinant fragment of Ki-67. In the immunohistochemical studies it
have been shown that significant quantities of Ki-67 were detected in
the metaphase nuclei of the cells on the sections from breast cancer. A
pattern of localization suggested the Ki-67 DNA-binding activity. Using
DNAs from different sources (plasmid and genomic from eukaryotes) we
have shown that recombinant fragment of Ki-67 is really able to bind DNA
as it was detected by DNA retardation in agarose gels after incubation
with Ki-67 fragment (at ratio 1 molecule of 5 Kb plasmid DNA to 150
Ki-67 molecules nucleic acid have completely lost it’s mobility) and in
experiments with Ki-67 binding to DNAs immobilized on nitrocellulose
supports.

In conclusion, in the present study 33 new cancer-associated antigens
from human thyroid cancer and melanoma have been detected; the use of
Ki-67 recombinant fragment as the tool for diagnostics of melanoma looks
perspective; the DNA-binding ability of Ki-67 recombinant fragment may
be the direction of experiments for elucidation of the whole Ki-67
molecule function.  

Key words: SEREX, tumor-associated antigens, thyroid cancer, melanoma.

МЕТОДОЛОГІЯ SEREX

Сироватка пацієнта

Тканина ракової пухлини

Афінне очищення на

іммобілізованому лізаті BNN97

Виділення мРНК

Створення експресуючої кДНК бібліотеки

Афінне очищення на іммобілізованому лізаті Y1090

Скринування кДНК бібліотеки очищеною сироваткою

Ідентифікація і характеристика позитивних клонів

Відсутність реплікативного старіння (“імморталізація”)

Нечутливість до ріст-супресійних сигналів

(Білкова фосфатаза 1 )

Самодостатність у проліферативних сигналах

Послаблення індукції апоптозу

(ТВР- зв’язувальний фактор, кисла церамідаза )

(Альфа та подібний до бета катеніни, ТОВ)

Зміна цитоскелету/рухливості (інвазія/метастазування)

Генетична нестабільність

Стимуляція неоангіогенезу

(Кінектин, CDC42, міозин, колаген, ліпокортин2, тимозин ()

(Тимозин ()

Блокування клітинного диференціювання

(CENP-B, Кі-67)

15 кДа

25 кДа

Рис. 4. Рівень аутоантитіл проти рекомбінантного фрагмента Кі-67 у
сироватках хворих на онкологічні захворювання різної етіології і
практично здорових донорів, визначений методом ELISA: 1-норма; 2-
меланома; 3- рак молочної залози; 4- рак яєчників; 5- рак шийки матки;
6-рак товстого кишечнику; 7- рак шлунка; 8- рак щитовидної залози.
*······· рівень імунної відповіді на 3 стандартні відхилення вище
середньостатистичного значення контрольної групи

OD

405

1 2 3 4 5 6 7 8

Б

А

Кі-67

20 кДа

Ki-67

1 2 3 4 5 6

Рис. 8. Імуногістохімічна детекція ядерного антигену Кі-67 на
кріостатних зрізах сім’яних канальців людини за допомогою моноклональних
антитіл проти рекомбінантного фрагмента Кі-67 антигену. Збільшення Х100

Рис. 9. Схематичне зобра-ження стадій клітинного циклу, на яких було
детектовано Кі-67 за допомогою моноклональ-них антитіл проти
реком-бінантного фрагмента цього антигену. Розве-дення антитіл 1:100.
Збільшення 1х100

Похожие записи