НАЦІОНАЛЬНА АКАДЕМІЯ НАУК УКРАЇНИ

ІНСТИТУТ МОЛЕКУЛЯРНОЇ БІОЛОГІЇ ТА ГЕНЕТИКИ

МЕЛЕШКО Руслан Анатолійович

УДК 663.1+578.84+577.29

Одержання біологічно-активного пролактину людини із використанням
бакуловірусної експресійної системи

03.00.20 – біотехнологія

Автореферат

дисертації на здобуття наукового ступеня

кандидата біологічних наук

Київ – 2005

Дисертацією є рукопис.

Роботу виконано у відділі біохімічної генетики Інституту молекулярної
біології та генетики НАН України.

Науковий керівник: доктор біологічних наук,

старший науковий співробітник

Строковська Людмила Іванівна,

Інститут молекулярної біології та генетики НАН України,

провідний науковий співробітник відділу біохімічної генетики.

Офіційні опоненти: доктор біологічних наук,

старший науковий співробітник

Черних Світлана Ігорівна,

Інститут молекулярної біології та генетики НАН України,

провідний науковий співробітник відділу регуляторних

механізмів клітини;

доктор біологічних наук, професор

Бучацький Леонід Петрович,

провідний науковий співробітник Київського національного університету
імені Т.Г.Шевченка.

Провідна установа: Інститут мікробіології та вірусології імені Д.К.
Заболотного НАН України, м. Київ.

Захист дисертації відбудеться 21.06.2005 р. о 14 годині на засіданні
спеціалізованої вченої ради Д 26.237.01 Інституту молекулярної біології
та генетики НАН України за адресою: 03143, м. Київ, вул. Заболотного,
150.

З дисертацією можна ознайомитись у бібліотеці Інституту молекулярної
біології та генетики НАН України за адресою: 03143, м. Київ, вул.
Заболотного, 150.

Автореферат розіслано 20.05.2005 року.

Вчений секретар

спеціалізованої вченої ради

кандидат біологічних наук О.В.Підпала

ЗАГАЛЬНА ХАРАКТЕРИСТИКА РОБОТИ

Актуальність теми. На сучасному етапі розвитку суспільства біологія дає
початок технологіям, що можуть докорінно змінити життя людства.
Взаємодія молекулярної біології, генетики, генної інженерії, біохімії та
мікробіології створила передумови для розвитку нової галузі біології –
генної біоінженерії.

Серед продуктів, створених на основі генно-інженерних біотехнологій,
найбільшого поширення набули рекомбінантні білки фармацевтичного
призначення – білки, які знаходять застосування при лікуванні
різноманітних хвороб, виготовленні тест-систем і противірусних вакцин,
проведенні наукових досліджень. У клінічній практиці широко
використовуються отримані на основі генно-інженерних технологій білки
інсулін, ?-інтерферон, ?-інтерферон, еритропоетин,
гранулоцитарно-макрофагальний колонієстимулюючий фактор та інші. Щороку
поповнюється кількість противірусних вакцин, створених на основі
рекомбінантних білків.

Одержання вірусних вакцин, отримання гормонів людини з природних джерел
(органи та тканини людини, кров, сеча, амніотична рідина) не може
забезпечити кількісних показників, прийнятних для потреб медицини або
взагалі є неможливим. Використання генно-інженерних методів для
продукування рекомбінантних вірусних антигенів, гормонів значно розширює
можливості їхнього отримання порівняно з традиційними методами.

Розробка медичних засобів із використанням методів сучасної
біотехнології найактивніше ведеться в США, Японії та країнах Західної
Європи. Обсяг світового продажу біотехнологічних препаратів становить 39
млрд. доларів США (станом на 2003 рік). На даний час в розробці
знаходиться більше як 500 біологічних продуктів, отриманих за допомогою
методів генетичної та клітинної інженерії (Pharma Business, 2003). Це
інтерферони, інтерлейкіни, кон’югати моноклональних антитіл,
різноманітні вакцини. Використовуючи методи сучасної біотехнології
створюють продукти для діагностики in vitro в клінічних лабораторіях. Це
тести на ліки, токсичні та наркотичні речовини, гормональні тести,
маркери пухлин, тести на інфекційні хвороби. Обсяг світового продажу цих
продуктів у 2003 році становив понад 15 млрд. доларів США. Наш північний
сусід Росія також намагається завоювати певні позиції на світовому та
внутрішньому ринку збуту біотехнологічних препаратів. У Росії розгорнуто
виробництво рекомбінантних інтерферону, інтерлейкіну-1b, інтерлейкіну-2,
еритропоетину, фактора некрозу пухлин, лімфотоксину, антагоніста ІЛ-1
рецепторів. В Україні на сьогоднішній день виробляється лише один
препарат на основі інтерферону.

Наукові лабораторії провідних біотехнологічних компаній і дослідницьких
інститутів, що працюють в галузі рекомбінантних білків, концентрують
зусилля на двох напрямах: відкриття нових перспективних білків і
відповідних їм генів; розроблення і вдосконалення методів одержання
відомих білків – об’єктів біотехнологічного виробництва.

Пролактин є поліфункціональним білком, що бере участь у низці
фізіологічних процесів у ссавців, включаючи процеси осморегуляції,
розмноження, імунної відповіді, росту і розвитку. Зміна рівня пролактину
у кровотоці ссавців спостерігається при різних патологічних станах,
таких як: ішемія, експериментальний діабет, ниркова недостатність,
захворювання органів черевної порожнини, шизофренія тощо. Тому одержання
рекомбінантного пролактину є перспективним як для діагностики деяких
патологій, так і для регуляції його рівня в організмі.

Гормон пролактин людини (PRL) впродовж останнього десятиріччя є об’єктом
біотехнології, хоча значних масштабів його виробництво не сягає.
Незначні обсяги виробництва рекомбінантного пролактину зумовлені тим, що
сфера його застосування обмежується діагностичними тест-системами, в
терапевтичній практиці гормон практично не використовується. Проте деякі
властивості і останні дані про його функції в організмі свідчать, що цей
білок має певний потенціал для використання в лікарській практиці, а
отже, вважаються доцільними і дослідження, що стосуються методів його
одержання.

Зв’язок роботи з науковими програмами, планами, темами. Дисертаційна
робота виконувалась в рамках бюджетних науково-дослідних робіт відділу
біохімічної генетики “Дослідження структурно-функціональних взаємодій
геному вірусу і клітини в бакуловірусній експресійній системі” (№
державної реєстрації 0196U005246, 1996-2000 рр.) та “Розробка
лабораторного регламенту одержання біологічно-активного пролактину
людини з використанням бакуловірусної експресійної системи” (№ державної
реєстрації 0101U000008, 2001-2003 рр.), де дисертант був виконавцем
окремих розділів згідно з планом науково-дослідних робіт.

Мета та завдання дослідження. Метою досліджень було вивчення експресії
рекомбінантного пролактину людини з використанням бакуловірусної
експресійної системи (БЕС) та розробка лабораторного методу одержання і
очищення біологічно-активного рекомбінантного пролактину людини.

Для досягнення поставленої мети необхідно було вирішити такі завдання:

Сконструювати рекомбінантні бакуловіруси, що забезпечують експресію
рекомбінантного пролактину людини в клітинах комах.

Відпрацювати умови культивування й інфікування клітин для забезпечення
високого рівня експресії рекомбінантного білка.

Розробити методи очищення рекомбінантного пролактину.

Створити лабораторну методику одержання біологічно-активного
рекомбінантного пролактину із застосуванням БЕС.

Об’єкт дослідження – рекомбінантний пролактин людини.

Предмет дослідження – вивчення експресії внутрішньоклітинного та
секретованого рекомбінантного пролактину людини, метод очищення
рекомбінантного PRL, що забезпечує високий вихід зі збереженням
біологічної активності.

Методи дослідження – конструювання експресійних векторів, експресія
рекомбінантного білка в системі на основі вірусу ядерного поліедрозу
(ВЯП) та культури клітин комах, метал-афінна та гепарин-сефарозна
хроматографія, вестерн-блот аналіз вимірювання біологічної активності
білка.

Наукова новизна одержаних результатів. Уперше було синтезовано
рекомбінантний PRL людини в бакуловірусній експресійній системі на
основі ВЯП Malacosoma neustria (Mane), розроблено лабораторну методику
одержання і очищення біологічно-активного рекомбінантного пролактину
людини з клітин комах. Запропонована методика дозволяє отримати дві
форми рекомбінантного гормону – внутрішньоклітинну і секретовану у
кількостях 60 мг і 10 мг білка відповідно на один літр поживного
середовища. Біологічну активність обох форм підтверджено в експериментах
in vitro, продемонстровано високий вміст глікозильованої фракції для
секретованої форми пролактину.

Практичне значення одержаних результатів. Проведене нами системне
дослідження бакуловірусної експресійної системи, що забезпечує
посттрансляційне модифікування еукаріотичних білків, дозволило
запропонувати систему для одержання значної кількості рекомбінантного
гормону людини, ступінь очистки якого надає можливість використовувати
його в лабораторних дослідженнях. Отриманий нами рекомбінантний
пролактин може бути використаний як антиген для виготовлення
діагностикумів, а також в наукових дослідженнях для з’ясування
механізмів і спектра дії пролактину у зв’язку з перспективами
використання його у терапевтичній практиці.

Особистий внесок здобувача. Результати, які викладено в дисертації,
отримано та проаналізовано особисто автором або за його безпосередньої
участі у плануванні та проведенні експериментів, а саме: конструювання
рекомбінантних плазмід і рекомбінантних бакуловірусів, інфікування
культур клітин, аналіз білків у ПААГ, відпрацювання очистки білка
різними методами, визначення біологічної активності рекомбінатного
пролактину людини. Інтерпретацію та узагальнення одержаних результатів
проведено з науковим керівником д.б.н., с.н.с. Строковською Л.І.,
завідувачем відділу д.б.н. Соломком О.П і співробітником відділу к.б.н.
Кіхно І.М. та висвітлено у спільних друкованих працях.

Апробація результатів дисертації. Основні положення дисертації було
представлено на „Конференції учасників 28 Міжнародних навчальних курсів”
(Biological Research Center, Szeged, Hungary, 2001) і наукових семінарах
відділів біохімічної генетики, молекулярної генетики та генетики
клітинних популяцій ІМБіГ НАН України.

Публікації. За матеріалами дисертації опубліковано 4 статті у фахових
наукових виданнях.

Структура та обсяг дисертації. Дисертація складається зі вступу, огляду
літератури, матеріалів і методів, результатів експериментальних
досліджень, аналізу та узагальнення результатів дослідження, висновків
та списку використаних джерел. Дисертацію викладено на 126 сторінці
машинописного тексту, вона містить 37 рисунків. Список використаної
літератури охоплює 226 джерел.

ОСНОВНИЙ ЗМІСТ

Матеріали і методи дослідження.

Плазміди, бактеріальні штами, культура клітин комах. При конструюванні
транспортних векторів використовували плазміди рМ1.2 (отримана в нашій
лабораторії), pFastBacHTa і штам E.coli DH10Bac (GibcoBRL), плазміду
pMelBac i штами E.coli TG1 i DH5? (Invitrogen). Бактеріальні клітини
вирощували на середовищі LB.

Як клітини-хазяї для рекомбінантних вірусів використовували культури
клітин комах Ар (Anteraea pernyi), Sf9, Sf21 (Spodoptera frugiperdа), HF
(High Five,одержані з Trichopulsia ni) (Gibco BRL), які вирощували на
середовищі ТС100 з додаванням 10% ембріональної сироватки теляти (Gibco
BRL). Суспензійну культуру клітин HF вирощували на середовищі Express
Five SFM (Gibco BRL) без додавання сироватки.

Фракціонування розчинних і нерозчинних клітинних білків. Інфіковані
клітини (1·107) суспендували в 1 мл буфера А (20 мМ трис-НСl, 100 мМ
NaCl, 5 мМ ?-меркаптоетанол, рН 8,0). Клітини руйнували трикратним
швидким заморожуванням (рідкий азот) та відтаюванням (водяна баня,
+37?С), потім центрифугували протягом 15 хв при 14000 об/хв, +4?С.
Супернатант використовували для очистки розчинного PRL. Осад
використовували для солюбілізації і очистки рекомбінантного пролактину
із агрегатів.

Очистка розчинного rPRL. До супернатанту, одержаному, як описано вище,
додавали 100 мкл суспензії Со+2-агарози Talon (Clontech, США),
попередньо промитої буфером А та інкубували при похитуванні протягом
години. Осад смоли промивали 3 рази буфером А. Пролактин екстрагували
буфером Б (200мМ імідазоль, 20 мМ трис-HCl, 100 мМ NaCl рН 8,0) (3 рази
по 100 мкл при +4?С).

Очищення rHisPRL в денатуруючих умовах (Метод 1). Осад зруйнованих
клітин, одержаний як описано вище, суспендували в 2 мл денатуруючого
буфера В (6М гуанідин хлорид, 20 мМ фосфат натрію, 30 мМ NaCl) до
однорідної суспензії, потім пропускали 4 рази через голку №18. Далі
суміш центрифугували при 14000 об/хв протягом 15 хвилин. Осад відкидали,
до супернатанту додавали 100 мкл смоли Talon, попередньо промитої
буфером В. Інкубували при кімнатній температурі протягом години з
постійним похитуванням. Потім смолу 3 рази промивали буфером Г (8М
сечовина, 20 мМ фосфат натрію, 300 мМ NaCl, pH 8,0). Елюцію rPRL
проводили буфером Е (8М сечовина, 20 мМ фосфат натрію, 300 мМ NaCl, pH
4,5) і збирали 4-6 фракцій по 100 мкл. Після аналізу в ПААГ фракції, які
містили rPRL, об’єднували і діалізували протягом 48 годин проти буфера А
при поступовому його збільшенні з 10 до 100 об’ємів щодо об’єму rHisPRL.

Очищення rHisPRL в неденатуруючих умовах (Метод 2). Клітинний осад
суспендували в 2 мл денатуруючого буфера (4,5 сечовина, 20 мМ трис-HCl,
100 мМ NaCl, 5мМ ?-меркаптоетанол, рН 11,0) і інкубували протягом години
при кімнатній температурі і постійному гойданні. Після центрифугування
при 14000 об/хв на холоді осад відкидали, а супернатант інкубували ніч
при +4?С і похитуванні. Потім до проби по краплинам протягом години
додавали рівний об’єм розчину А і проводили діаліз протягом 24 годин
проти 1 л буфера зі зміною буфера через 12 годин. Очищення білка за
допомогою Со+2-агарози проводили, як описано для розчинного rPRL.

Тестування біологічної активності rPRL. Біологічну активність PRL
оцінювали в проліферативному тесті з використанням пролактинозалежних
Nb-2 клітин пролактиноми щура. Клітини витримували у вигляді
суспензійної культури в середовищі Фішера з додаванням 10% сироватки
теляти і кінської сироватки. Тест було виконано за загальною методикою,
кількість клітин було визначено за допомогою методу колориметрії з
використанням МТТ ( 3-4,5 диметилтіанозол-2-дифеніл-тетразолін бромід).
Nb2 клітини були люб’язно надані доктором Келлі (INSERM, Франція).

Приготування лізату клітин для розділення білків в ПААГ. Осад, одержаний
із суспензії, яка містила 106 клітин комах, ресуспендували в 200 мкл
розчину 0,01 M трис-HCl, pH 8,0, 0,001 M EDTA, 1% SDS, 5%
?-меркаптоетанолу, 10% гліцерину, 0,001% бром фенолу, прогрівали при
+95?С протягом 5 хв і центрифугували 5 хв при 14000об/хв. Для нанесення
в лунку використовували 5-20 мкл зразка.

Результати дослідження та їх обговорення.

Клонування гена пролактину людини в транспортному векторі pM1.2 та
отримання рекомбінантного ВЯП ManePRL. В роботі було використано кДНК
пролактину людини, яку було синтезовано в лабораторії Шведа А.Д. (ІМБіГ
НАНУ) і люб’язно надано для роботи. кДНК було синтезовано для експресії
в бактеріальній системі, тому вона не містила ділянки, що кодує
сигнальний пептид, який відповідає за секреторну функцію білка. Вона
містить послідовність в 30 нуклеотидів, яка включає сайт для рестриктази
BamHI, ділянку зв’язування з рибосомною РНК Е.coli та ініціюючий кодон.

Геном бакуловірусів досить великий, кільцевозамкнений і має велику
кількість сайтів впізнавання для різних рестриктаз. Тому отримати
рекомбінантний вірус, що несе вбудований під промотор поліедрину ген
білка прямим клонуванням неможливо. Для одержання рекомбінантного ВЯП
ManePRL ми скористалися традиційним шляхом, що складається з 2 етапів –
конструювання рекомбінантного човникового вектора та одержання
рекомбінантного вектора.

На першому етапі для конструювання рекомбінантного човникового вектора
за основу нами було обрано плазміду pM1.2, одержану в нашій лабораторії
раніше. В ділянці ініціюючого кодону поліедрину в цій плазміді вбудовано
лінкерну ділянку з сайтом для BamHI, при цьому частину кодуючої ділянки
гена поліедрину від +1 до +144 видалено. Ця конструкція дозволила
вбудувати кДНК пролактину з власним АТG кодоном безпосередньо під
промотор гена поліедрину (плазміда рМ-PRL).

На другому етапі було зроблено котрансфекцію плазмідною та
бакуловірусною ДНК клітин комах (у співвідношенні 5:1). Вихід
рекомбінантних вірусів ManePRL становив 0,1-1%.

Клонування гена пролактину людини в транспортному векторі pFastBac та
отримання рекомбінантної бакміди AcPRL. Для експресії рекомбінантного
пролактину людини було також застосовано комерційну бакуловірусну
Bac-to-Bac систему.

Для цього нами було проведено клонування гена пролактину у транспортний
вектор pFastBac. Із човникової плазміди pM-PRL було отримано кДНК гена
пролактину за допомогою реакції ампліфікації з використанням таких
праймерів:

5′- CGGGATCCCATGTTGCCCATCTGTCCCGGC – що містить BamHI сайт

3′-GGGGTACCAATTCGAAGCAAGCAATGGAACG – що містить KpnI сайт.

Ампліфікований фрагмент було очищено за допомогою набору QAEXII(Quagen)
і вбудовано у плазміду pFastBac за сайтами BamHI-KpnI. Отримана
рекомбінантна плазміда pFastPRL містить кДНК пролактину під промотором
гена поліедрину ВЯП Аutographa californica.

Рекомбінантною плазмідою були трансформовані клітини E.coli DH10Bac з
метою транспозиції кДНК пролактину в бакуловірусну геномну ДНК
(бакміду). З отриманих білих колоній виділяли препарати бакмідної ДНК.
Наявність гена пролактину і відсутність бакмідної ДНК дикого типу
контролювали за допомогою реакції ампліфікації з використанням
відповідних праймерів згідно протоколів фірми-виробника. Одержані
рекомбінантні бакміди використовували для трансфекції клітин Sf9. В
результаті отримано рекомбінантний вірус AcPRL, який в подальшому
використовували для експресії пролактину в клітинах комах.

Експресія рекомбінантного пролактину в системі на основі ВЯП Mane та
клітин Ap. Моношарову культуру клітин Ар інфікували рекомбінантним
вірусом ManePRL з множинністю 10 бляшкоутворюючих одиниць (БУО) на
клітину. Через 5 днів після інфікування сумарні білки клітин розділяли
за допомогою SDS ПААГ з метою виявлення в них пролактину. Як видно з
наведеної електрофореграми (рис. 1) в клітинах, які інфіковані
рекомбінантним вірусом, присутній білок, що відсутній в неінфікованих
клітинах і клітинах, інфікованих вірусом дикого типу.

Молекулярна маса його знаходиться в межах 23 кДа, що відповідає
молекулярній масі пролактину людини. Процентний вміст його вираховували
за денситограмами електрофореграм (рис. 1). Він становить приблизно 8%
від усієї кількості кумасі-пофарбованих білків, що відповідає 50-70 мг/л
поживного середовища. Така кількість синтезованого рекомбінантного
пролактину свідчить про ефективну експресію пролактину в нашій
бакуловірусній системі.

Експресія рекомбінантного пролактину в системі Bac-to-Bac.
Рекомбінантним вірусом AcPRL проінфікували клітини комах ліній Sf9, Sf21
i HF. Клітини було зібрано на 4-й день після інфікування.
Електрофореграми загального білкового складу інфікованих клітин ліній
Sf9, Sf21 i HF свідчать, що вміст пролактину в для клітин ліній Sf
становить 14% і для клітин HF 28% від загальної кількості білків (85
-120 мг на 1 л поживного середовища та 175 -245 мг/л відповідно) (рис.
2).

Одержані результати свідчать про ефективну експресію пролактину як в
розроблюваній нами, так і в комерційній бакуловірусних системах і
перспективність одержання цього білка генно-інженерним способом.

Таким чином, нами одержано ефективну експресію рекомбінантного
пролактину людини із застосуванням бакуловірусних систем на основі: ВЯП
ManePRL і моношарової культури клітин Ар та ВЯП АсPRL i моношарових
культур клітин HF, Sf9, Sf21.

Одержання модифікованих форм рекомбінантного пролактину з метою
оптимізації процесу очищення гормону з максимально збереженою
біологічною активністю. Спираючись на дані рівня експресії пролактину
при використанні ВЯП ManePRL, та ВЯП АсPRL, а також беручи до уваги
значно простіший та швидший спосіб отримання рекомбінантного вірусу,
наявність комерційних моношарових та суспензійних культур клітин комах
для підбору найпродуктивнішої комбінації хазяїн-вірус було вирішено
подальшу роботу по вдосконаленню методів одержання і очищення
рекомбінантного пролактину проводити на основі комерційних систем
Bac-to-Bac і MaxBac. З метою подальшого вдосконалення системи одержання
рекомбінантного пролактину необхідно було вирішити такі завдання:

Для забезпечення можливості очистки внутрішньоклітинного rPRL за
допомогою метал-афінної хроматографії створити рекомбінантний вірус, що
експресує rPRL з 6 додатковими залишками гістидину у своєму складі.

Для полегшення процесу очищення і забезпечення максимального збереження
нативної конформації та відповідно біологічної активності rPRL створити
рекомбінантний вірус, що експресує секретований гормон.

Підібрати умови культивування клітин комах, умови їхнього інфікування
рекомбінантним вірусом, час після інфікування для збору інфікованих
клітин і середовища, які є оптимальними для досягнення максимального
виходу продукту.

Підібрати метод очищення rPRL, що забезпечує високий вихід і збереження
біологічної активності білка.

Конструювання рекомбінантного вірусного вектора для експресії
внутрішньоклітинного rPRL. Для того, щоб зробити можливою очистку PRL з
використанням принципів метал-афінної хроматографії, необхідно отримати
білок, що несе 6 залишків амінокислоти гістидину у своєму складі. Для
вбудови додаткових нуклеотидів, які кодують гістидинові залишки, було
обрано 5?-кінець гена PRL. Вищезгадану кДНК PRL було клоновано під
промотор гена поліедрину в плазміді pFastBacHTa, результатом цього було
подовження 5?-кінця гена PRL на 84 нуклеотиди, які включали
послідовність, що кодує 6 залишків гістидину і сайт розщеплення rTEV
протеазою (рис. 3). Рекомбінантною плазмідою трансформували клітини E.
coli DH10Bac з метою подальшої транспозиції кДНК PRL в бакуловірусну
геномну ДНК (бакміду). Для продукування рекомбінантного бакуловірусу
рекомбінантну бакмідну ДНК було використано для трансфекції клітин Sf9,
рекомбінантний вірус було зібрано на 72-й годині після інфікування. В
результаті описаних маніпуляцій було отримано рекомбінантний вірус
AcHisPRL.

Конструювання рекомбінантних вірусних векторів для експресії
секретованого rPRL. Для того, щоб подолати проблему агрегування rPRL у
клітинах комах і одержати розчинну секретовану форму цього білка, ми
використали комерційну БЕС MaxBac (Invitrogen), яка забезпечує секрецію
в середовище гетерогенних білків. кДНК PRL було клоновано в плазміді
pMelBacB під промотор гена поліедрину в рамці зчитування з послідовністю
сигнального пептиду мелітину бджоли. Схему химерної
мелітин-пролактинової ДНК представлено на рис. 3. В результаті
котрансфекції рекомбінантного транспортного вектора з вірусною
Bac-N-Blue ДНК і подальшого відбору рекомбінантних бляшок було одержано
рекомбінантний вірус AcMelPRL.

Систему MaxBac було використано також для одержання рекомбінантного
вірусу AcMelPRLHis, що несе у своєму складі ген PRL, модифікований таким
чином, щоб продукт цього гена мав у своєму складі 6 залишків гістидину
на С-кінці і сигнальний пептид мелітину бджоли на N-кінці (рис. 3).

Таким чином в результаті генно-інженерних маніпуляцій нами одержано
серію рекомбінантних бакуловірусних векторів, а саме:

1. Рекомбінантний вірус AcHisPRL – для експресії внутрішньоклітинного
пролактину. Мета введення додаткових 6His амінокислот у склад PRL, що
має експресуватися цим вектором, полягає в полегшенні очистки
рекомбінантного білка. У разі необхідності додаткові амінокислоти можуть
бути видалені шляхом обробки білка rTEV протеазою.

2. Рекомбінантний вірус AcMelPRL – для експресії секретованого rPRL.
Мета одержання розчинної форми rPRL, що секретується в середовище,
полягає в намаганні уникнути стадії солюбілізації білка з агрегатів, що
ускладнює процес очистки і може призвести до часткової втрати білком
його біологічної активності. Перевагою такої форми rPRL є також те, що
вона максимально наближена до природного аналога гормону, оскільки не
несе додаткових амінокислот в своєму кладі (що однак виключає можливість
застосування метал-афінної хроматографії для очистки білка).

3. Рекомбінантний вірус AcMelPRLHis – для експресії секретованого
PRLHis. Введення залишків гістидину до складу секретованого PRL має на
меті поєднання переваг і подолання недоліків вищезгаданих форм
пролактину – експресований в середовище розчинний білок має підлягати
очистці в неденатуруючих умовах із застосуванням метал-афінної
хроматографії.

Експресія внутрішньоклітин-ного і секретованого rPRL. Для експресії
внутрішньоклітинного пролактину були використані клітини S21 i HF.

При інфікуванні клітин рекомбінантними вірусами AcPRL і AcHisPRL вже
через 48 годин при аналізі під мікроскопом в клітинах Sf21 i HF виявляли
включення. Такі включення були відсутні в здорових клітинах і в
клітинах, які інфіковані вірусом дикого типу. При аналізі білків із
заражених реком-бінантними вірусами AcPRL і AcHisPRL клітин HF в ПААГ і
порівняння їх з патерном білків із клітин, інфікованих ВЯП Ас було
виявлено суперекспресію білка з молекулярною масою 23-25 кДа, та білка з
молекулярною масою 28-30 кДа відповідно (рис 4). Вестерн-блотинг із
наступною імуно-детекцією підтвердив, що цей білок є пролактином.

.   Ue I

?

???  Ue L

E

E

I

a

ae

OJPJQJ

@

??????? дні після інфікування, які можна було візуалізувати за допомогою
мікроскопу. Клітини відрізнялися від клітин інфікованих вірусом AcHisPRL
відсутністю гранулярних структур, а також спостерігали збільшення
кількості клітин, що знаходяться в стадії поділу, деякі з них мали
відростки.

На десяту добу після інфікування рекомбінантним вірусом AcMelPRL з
множинністю 0,1-0,2 БУО/кл було зафіксовано відсутність ознак лізису або
загибелі клітин. Звичайно клітини комах через 3-5 днів після інфікування
диким чи рекомбінантним ВЯП Ас при аналогічній множинності інфікування
починають руйнуватися і їхній вміст потрапляє в поживне середовище.

Електрофоретичний аналіз білків, що присутні в поживному середовищі при
інфікуванні AcMelPRL наведено на рис. 5. Вестерн-блотинг із наступною
імунодетекцією підтвердив наявність пролактину.

Таким чином було отримано експресію внутрішньоклітинного rHisPRL і
секретованих форм rPRL в клітинах Sf21 i HF. Виявлено позитивний вплив
секретова-них форм rPRL на ріст і виживання клітин-хазяїв.

Порівняння рівнів експресії rPRL в культурі клітин комах при різних
умовах їхнього культивування. Як показали результати електрофоретич-ного
аналізу, найвищі рівні експресії внутрішньо клітин-ного rPRL
забезпечували клітини HF. Клітини цієї лінії було адаптовано до
суспензійного культивування. В інфікованих HF клітинах при суспензійному
культивуванні вдалося досягти вищих кількісних показників rPRL порівняно
з клітинами, що культивувалися у моношарі. Для внутрішньоклітинної і
cекретованої форми rPRL спостерігали приблизно дворазове підвищення
кількості пролактину при перерахунку на 1 л поживного середовища, що
становило 500 мг та 20 мг відповідно (рис. 6). При суспензійному
культивуванні густина інфікованих клітин в середовищі приблизно вдвічі
вища, ніж при моношаровому культивуванні. Природно припустити, що
підвищення кількості rPRL є наслідком цього факту.

Дослідження залежності кількісних характеристик експресованого rPRL від
МІ і часу після інфікування. Суспензійну культуру клітин HF було
інфіковано вірусами AcHisPRL i AcMelPRL з використанням різних
множинностей інфікування – 0,1, 1, 5, 10. Клітини і середовище було
відібрано на 48-й годині після інфікування і їхній білковий склад
піддано електрофоретичному аналізу. В результаті проведеного аналізу
встановлено, що найвищих рівнів експресії було досягнуто в культурах,
які інфіковані з множинністю 1, 5 і 10, причому кількості rPRL в
клітинах, які інфіковані з множинністю 1, 5 i 10 суттєво не відрізнялися
(рис. 7).

Очищення rHisPRL, характеристика і оцінка біологічної активності
очищенного білка. Накопичення рекомбінантних білків у вигляді тілець
включення певною мірою спрощує їхню очистку, оскільки робить можливим
вилучення агрегатів із загального пулу білків простим руйнуванням клітин
і осадженням їх за допомогою центрифугування. Проте значним недоліком
при цьому є те, що солюбілізація білків із таких частково очищених
агрегатів потребує денатуруючих умов, що призводить до втрати білком
нативної конформації.

Для відновлення нативної конформації і, як наслідок, біологічної
активності рекомбінантного білка, зазвичай, необхідно випробовувати
різні умови ренатурації, щоб досягти правильного складання молекули.
Наявність трьох S-S-містків у структурі молекули PRL вказує на особливу
важливість підбору правильних умов денатурації-ренатурації для
забезпечення правильного формування її третинної і четвертинної
структури.

Очищення за допомогою Методу 1.

Як правило, рекомбінантний пролактин із гранул (одержаний в системі
E.coli) солюбілізують за допомогою жорсткої обробки денатуруючими
агентами, такими як 8М сечовина і 6М гуанідин хлорид. Ми використали ці
реагенти для очистки rHisPRL із клітин комах із застосуванням
Со2+-афінної хроматографії в денатуруючих умовах. Афінність гістидинових
залишків, які містяться на N-кінці молекули rPRL, до двовалентних
катіонів забезпечує специфічне зв’язування рекомбінантного білка з
Со2+-вміщуючою смолою, що дозволяє в одностадійному процесі очистки
одержати денатурований білок з мінімальною кількістю домішок. Фракції
денатурованого rPRL, ощищеного на смолі Talon, були об’єднані та
діалізовані проти буферу, об’єм якого поступово збільшували з метою
правильної ренатурації пролактину. В таких умовах процеси окислення -SH-
груп і ренатурації білка відбуваються одночасно. Після діалізу було
виміряно концентрацію rPRL і визначено його біологічну активність як
описано нижче. Електрофореграму очищеного за даною методикою пролактину
подано на рис. 8A.

Застосування методу одностадійної очистки внутрішньоклітинного rHisPRL
на Со2+-афінній смолі Talon в денатуруючих умовах дозволило одержати
рекомбінантний білок у кількості 60 мг в перерахунку на 1 л
культуральної рідини.

Очищення за допомогою Методу 2.

Умови солюбілізіції та ренатурації за Методом 1 могли бути неідеальними
для даного білка i призвести до часткової втрати ним його біологічної
активності. Тому з метою пошуку найефективнішого підходу ми застосували
нещодавно опублікований метод очищення rPRL, який дозволяв одержувати
біологічно-активний гормон із тілець включення клітин E.coli (Peterson
at all, 1999).

Порівняно з попереднім методом, денатурацію пролактинових агрегатів
проводили у більш м’яких умовах, використовуючи як денатуруючий агент
4,5М сечовину. Очистці солюбілізованого з агрегатів rHisPRL на колонці
передувало довготривале інкубування розчину денатурованого білка при 4оС
з метою поступового окислення -SH- груп і подальший діаліз з метою
ренатурації молекул rHisPRL. Розчин ренатурованого таким чином білка
наносили на колонку з Talon і проводили процедуру промивки колонки і
елюції зв’язаного з колонкою rHisPRL в неденатуруючих умовах (рис. 8 Б).

Кількісні показники солюбілізованого з агрегатів, окисленого,
ренатурованого і очищеного в неденатуруючих умовах rHisPRL були дещо
нижчими (40 мг на 1 л поживного середовища) порівняно з тими, що
одержані із застосуванням методу очистки в денатуруючих умовах з
подальшою ренатурацією.

Вимірювання біологічної активності ренатурованого rHisPRL. Для перевірки
чи є біологічно активним rPRL людини, експресований в клітинах комах і
очищений з агрегатів із застосуванням двох методів, було проведено
дослідження проліферативної активності рекомбінантного білка в тесті in
vitro. В цьому тесті використовується здатність PRL людини взаємодіяти з
гетерологічними рецепторами клітин лімфоми щура (Nb2), стимулюючи їхню
проліферацію. Після 72 годин інкубації Nb2 клітин з різними кількостями
очищеного rHisPRL підраховували кількість клітин. Графік залежності
кількості клітин від концентрації PRL наведено на рис. 9. Як свідчать
результати тесту, очищений білок біологічно активний. Концентрація
очищеного в денатуруючих умовах rHisPRL, необхідна для подвоєння
кількості Nb2 клітин становила 471 ±21 пкг/мл і була навіть дещо нижчою
за значення, одержані для контрольного гіпофізарного пролактину людини –
625±49 пкг/мл. Близькі до цього значення показники були одержані і для
rHisPRL, очищеного із застосуванням методу очищення в неденатуруючих
умовах.

Таким чином, експресований в клітинах комах і очищений rHisPRL був
біологічно активним в системі тестування проліферативної активності in
vitro. Активність препаратів rHisPRL, очищених із застосуванням обох
методів, була приблизно однаковою. Оскільки кінцевий вихід білка,
очищеного за Методом 2 є меншим, ніж його кількість, одержана при
застосуванні Методу 1, і до того ж в першому випадку процедура
денатурації-ренатурації займає більше часу, застосування Методу 1
видається доцільнішим.

Очищення і біологічна активність секретованого rPRL.

Визначення біологічної активності розчинних форм rPRL за допомогою
проліферативного тесту in vitro не потребує вилучення рекомбінантного
білка із середовища, тому для перевірки активності секретованих форм
білка можна використовувати аліквоти культуральної рідини, в якій росли
клітини, інфіковані вірусами AcMelPRL i AcMelPRLHis. Обидві секретовані
форми rPRL були біологічно активними. Проте спостерігали значну різницю
у кількостях rPRL-вміщуючої культуральної рідини, необхідної для
подвоєння кількості Nb2 клітин. Для досягнення такого ж ефекту необхідно
було внести в 1000 разів більшу кількість секретованого rPRLHis в
середовище, в якому вирощували Nb2 клітини, порівняно з кількістю
секретованого rPRL (рис. 10).

Одержані результати свідчили про те, що наявність 6 додаткових залишків
гістидину на С-кінці молекули rPRL негативно впливають на збереження
білком його біологічної активності.

Така низька біологічна активність His-вміщуючого секретованого rPRL
свідчила про недоцільність використання вірусу AcMelPRLHis як
експресійного вектора для продукування секретованої форми пролактину.

Для очистки секретованого rPRL нами було обрано метод, що базується на
природній здатності PRL людини до зв’язування з гепарином. PRL людини є
єдиним з-поміж охарактеризованих пролактинів різних організмів, що
ідентифікується як гепарин-зв’язувальний білок.

Поживне середовище із 100 мл суспензійної культури клітин HF, які
інфіковані вірусом AcMelPRL з множинністю інфікування 1 було відібране
на 48-й годині після інфікування. Звільнений від клітин центрифугуванням
і сконцентрований сульфатом амонію, розчин rPRL було нанесено на колонку
з гепарином, колонку було відмито і rPRL елюйовано буферними розчинами
із ступінчато зростаючою концентрацією NaCl. Елюат використовували для
електрофоретичного аналізу (рис. 11, 12) і для вимірювання активності
rPRL. Рівень rPRL у середовищі і в препараті після очищення на
гепарин-сефарозі визначали за допомогою імуно-ферментного методу на
автоматичному аналізаторі Axym (Abbot Laboratory, Abbot Park, IL). При
визначенні активності було встановлено, що концентрація пролактину,
необхідна для досягнення половини максимального приросту клітин Nb2 для
пролактину людини, становить 510±35 і 480±28 пг/мл для препарату rPRL,
який було очищено на гепарин-сефарозній колонці. Ці дані демонструють,
що секретований рекомбінант-ний пролактин людини має приблизно таку ж
активність, як і пролактин людини.

Кількість rPRL у середовищі становила приблизно 20-30 мг/л. Кількість
PRL у фракції (V=2мл) після очистки на колонці складала близько 500
мкг/мл. Загальна кількість очищеного rPRL становила 10 мг/л середовища,
що свідчить про те, що в процесі очищення і концентрування губиться
більше, ніж 50% наявного білка.

Ідентифікація різних форм rPRL. Вестерн-блотинг із наступною
імунодетекцією секретованого rPRL продемонстрував наявність двох смуг,
що зв’язують антипролактинові антитіла (рис. 13). Ми детально не
досліджували природи форм rPRL, які відповідають цим смугам, проте
порівняння одержаних результатів з даними інших дослідників дозволило
зробити припущення, що білок з молекулярною масою 23 кДа відповідає
неглікозильованій формі rPRL, білок з молекулярною масою 25 кДа є його
глікозильованою формою.

Внутрішньоклітинний rHisРRL експресується в трьох формах (рис. 13).
Різниця молекулярної маси кожної з двох форм, порівняно з такими
секретованого rPRL, становить приблизно 5 кДа (смуги 28, 30 кДа
внут-рішньоклітинного rPRL відповідають смугам 23, 25 кДа секретованого
гормону), що є наслідком наявності додаткових 26 амінокислотних залишків
в молекулі rHisPRL. Додаткова смуга, яка відповідає білку з молекулярною
масою 58 кДа, очевидно, є димеризованою формою rHisPRL.

Важливо зазначити, що для секретованого гормону кількість
глікозильованої форми (смуга 25 кДа) значно вище порівняно з
внутрішньоклітинним rHisPRL і становить 20-50% від загальної кількості
очищеного білка.

Результатом проведеної роботи стало створення лабораторної методики
одержання і очистки рекомбінантного пролактину із застосуванням БЕС.

Запропонована нами методика дозволяє отримати дві форми рекомбінантного
гормону – внутрішньоклітинну і секретовану у кількостях 60 мг і 10 мг
відповідно на 1 л культурального середовища. Біологічну активність обох
форм підтверджено в експериментах in vitro, продемонстровано високий
процентний вміст глікозильованої фракції для секретованої форми
пролактину.

Важливо зазначити, що для секретованого гормону кількість
глікозильованої форми (смуга 25 кДа) значно вище порівняно з
внутрішньоклітинним rHisPRL і становить до 50% від загальної кількості
очищеного білка. В гіпофізі людини глікозильваний пролактин може
становити від 5 до 40% від загальної кількості гормону. Співвідношення
глікозильованого/неглікозильованого пролактину залежить від певних
фізіологічних станів, а також може вказувати на прояви деяких
захворювань і може використовуватись для подальших досліджень.

ВИСНОВКИ

В дисертаційній роботі досліджено експресію рекомбінантного пролактину
людини в бакуловірусній експресійній системі. Розроблено методи очистки
біологічно-активного білка.

Сконструйовано рекомбінантні бакуловіруси ManePRL, AcPRL, AcHisPRL,
AcMelPRL та AcMelPRLHis, що несуть ген пролактину під промотором гена
поліедрину.

Одержано ефективну експресію рекомбінантного пролактину людини в
культурі клітин Ар (50-70 мг на 1 л поживного середовища), Sf (85 -120
мг/л) та HF (175 -245 мг/л).

Підібрано оптимальні умови для експресії рекомбінантного пролактину
людини – культивування в суспензійній культурі та умови інфікування
клітин, що забезпечило високий рівень експресії rPRL – близько 500 мг/л
внутрішньоклітинного і близько 30 мг/л секретованого.

Розроблено методи очищення внутрішньоклітинного rPRL (метал-афінна
хроматографія) та секретованого (гепарин-афінна хроматографія), які
дозволили одержати високий рівень очистки рекомбінантного білка (95%).

Застосування розроблених методів дозволило отримати до 60 мг/л очищеного
внутрішньоклітинного rPRL, та до 10 мг/л секретованого rPRL на 1 л
поживного середовища.

На основі одержаних результатів розроблено лабораторну методику
одержання біологічно-активного внутрішньоклітинного і секретованого
рекомбінантного пролактину із застосуванням БЕС.

ПЕРЕЛІК НАУКОВИХ ПРАЦЬ, ОПУБЛІКОВАНИХ ЗА ТЕМОЮ ДИСЕРТАЦІЇ

Строковская Л.И., Мелешко Р.А., Кихно И.М., Соломко А.П. Сравнительное
исследование эффективности экспрессии рекомбинантного пролактина
человека в двух бакуловирусных системах // Біополімери і клітина. –
2002. – Т. 18, №5. – С. 423-428.

Особистий внесок здобувача – конструювання рекомбінантних плазмід і
рекомбінантних бакуловірусів, інфікування культур клітин, аналіз білків
у ПААГ.

Kihno I.M., Strokovskaya L.I., Meleshko R.A., Michalic J., Solomko A.P
Physical mapping of Malacosoma neustria nuclear polihedrosis virus
genome and its modification in Аnthenaraea pernyi cell culture //
Біополімери і клітина. – 2002. – Т. 18, №6. – С. 522-528.

Особистий внесок здобувача – рестрикційний аналіз ДНК, складання
фізичної карти.

Строковская Л.И., Мелешко Р.А., Кихно И.М., Соломко А.П. Очистка
внутриклеточного рекомбинантного пролактина человека, синтезированного в
клетках насекомых с помощью бакуловирусного вектора // Біополімери і
клітина. – 2004. – Т. 20, №3. – С. 1-6.

Особистий внесок здобувача – конструювання рекомбінантних плазмід і
рекомбінантних бакуловірусів, відпрацювання очистки білка Методом 1 та
Методом 2, аналіз білків у ПААГ.

Строковская Л.И., Кихно И.М., Мелешко Р.А., Соломко А.П. Экспрессия
секретируемого рекомбинантного пролактина человека в клетках насекомых
// Біополімери і клітина. – 2004. – Т. 20, №4. – С. 325-330.

Особистий внесок здобувача – конструювання рекомбінантних плазмід і
рекомбінантних бакуловірусів, аналіз білків у ПААГ.

АНОТАЦІЯ

Мелешко Р.А. Одержання біологічно-активного пролактину людини з
використанням бакуловірусної експресійної системи.– Рукопис.

Дисертація на здобуття наукового ступеня кандидата біологічних наук за
спеціальністю 03.00.20 – біотехнологія. – Інститут молекулярної біології
та генетики НАН України, Київ, 2005.

Дисертація присвячена вивченню експресії рекомбінантного пролактину
людини з використанням бакуловірусної експресійної системи (БЕС) та
розробці лабораторної методики одержання і очищення біологічно-активного
рекомбінантного пролактину людини.

Вперше було синтезовано рекомбінантний PRL людини в бакуловірусній
експресійній системі на основі ВЯП Malacosoma neustria (Mane).
Сконструйовано рекомбінантні бакуловіруси, що забезпечують експресію
внутрішньоклітинного та секретованого рекомбінантного пролактину людини
в клітинах комах.

Відпрацьовано умови культивування клітин, інфікування їх вірусом,
визначено оптимальний час після інфікування для збору клітин і
середовища з метою досягнення максимальних рівнів експресії пролактину,
розроблено методи очищення біологічно-активного рекомбінантного
пролактину людини, що дозволяє отримати дві форми рекомбінантного
гормону – внутрішньоклітинну і секретовану у кількостях 60 мг і 10 мг
білка відповідно на один літр поживного середовища.

На базі проведених досліджень запропоновано лабораторну методику
одержання біологічно-активного рекомбінантного очищенного пролактину
людини.

Ключові слова: бакуловірусна експресійна система, пролактин, експресія.

АННОТАЦИЯ

Мелешко Р.А. Получение биологически-активного пролактина человека с
использованием бакуловирусной эспресионной системы.– Рукопись.

Диссертация на соискание ученой степени кандидата биологических наук по
специальности 03.00.20 – биотехнология. – Институт молекулярной биологии
и генетики НАН Украины, Киев, 2005.

Диссертация посвящена изучению экспрессии рекомбинантного пролактина
человека с использованием бакуловирусной экспрессионной системы (БЭС) и
розработке лабораторной методике получения и очистки
биологически-активного рекомбинантного пролактина человека.

Впервые был синтезирован рекомбинантный PRL человека в бакуловирусной
єкспрессионной системе на основе ВЯП Malacosoma neustria (Mene).
Сконструировано рекомбинантные бакуловирусы, которые обеспечивают
экспрессию внутриклеточного и секретируемого пролактина человека в
клетках насекомых.

Отработаны условия культивирования клеток, инфицирования их вирусом,
определено оптимальное время после инфицирования для сбора клеток и
среды с целью достижения максимальных уровней экспрессии пролактина,
разработаны методы очистки биолоически-активного рекомбинантного
пролактина человека, что позволяет получить две формы рекомбинантного
гормона – внутриклеточную и секретируемую в количествах 60 мг и 10 мг
белка соответственно на один литр питательной среды.

На базе проведенных исследований предложена лабораторная методика
получения биологически-активного рекомбинантного очищенного пролактина
человека.

Ключевые слова: бакуловирусная экспрессионная система, пролактин,
экспрессия.

SUMMARY

Meleshko R.A. Production of human biologically active prolactin by using
baculovirus expresson system. – Manuscript.

Thesis for a Philosophy Doctor (Ph.D.) degree in Biology by speciality
03.00.20 – biotechnology. – Institute of Molecular Biology and Genetics
of National Academy of Science of Ukraine, Kyiv, 2005.

The thesis is devoted to the elaboration of expression of human
prolactin by using baculovirus expresson system with following
purification of biologically active recombinant hormone.

Prolactin is a polypeptide hormone secreted by the pituitary gland. PRL
regulates multiple physiological functions. Prolactin present in mammals
in several forms is heterogenous and apparently is a subject of
posttranslational modifications including glycosilation,
phosphorylation, proteolytic cleavage, and amidation. This was the
reason for choosinge the baculovirus expression system since this
system produces foreign protein in large quantity and, in most cases,
the recombinant proteins are processed and modified in a manner similar
to that of their authentic counterparts.

The effective expression of human recombinant prolactin has been
reached by using of baculovirus expression system on the basis of:
Malacosoma neustria nuclear polyhedrosis virus (NPV) – Antheraea pernyi
insect monolayer cell culture. This system was elaborated in IMBiG
NASU as a prospective alternative of other commonly used baculovirus
expression system. But the disadvantage of Malacosoma neustria as a
vector is impossibility to use different cellular lines for its
production due to restricted host range for this virus.

During past 10-15 years the most commonly baculovirus Autographa
californica nuclear polyhedrosis virus (AcMNPV) system was used. For
this particular system a wide spectrun of convenient transfer vectors
was developed, making cleaning of proteins synthesized in this system
relatively simple and easy. We used for expression of human recombinant
prolactin recombinant viruses АcMNPV and Hf, Sf9, Sf21 insect
monolayer cell cultures. Recombinant АcMNPV – Hf cells system
demonstrated the highest level of prolactin expression (245 mg/L),
due to this fact it was chosen for further work on the way to production
of different forms of recombinant prolactin.

Several recombinant Autographa californica nuclear polyhedrosis virus
vectors were designed:

1. AcHisPRL vector, which contains cDNA human prolactin with the
nucleotide sequence on the 5′ terminus that encodes 6 histidine residues
for the intracellular chimeric prolactin expression.

2. AcMelPRL vector, which contains cDNA of human prolactin with the
nucleotide sequence on the 5′ terminus that encodes the signal peptide
of bee melitin for the secreted prolactin expression.

3. AcMelPRLHis vector, which contains cDNA of human prolactin with the
nucleotide sequence on the 3′-terminus that encodes 6 histidine
residues and with the nucleotide sequence on the 5′-terminus that
encodes the signal peptide of bee melitin for the secreted chimeric
prolactin expression.

It was demonstrated decreased biological activity of His-containing
secreted prolactin (MelPRLHis) and instability of its expression
levels in insect cells. Due to these facts it was concluded that
production of this form of hormone wasn’t prospective.

The HF cells provided the high stable levels of expression of both
intracellular (HisPRL) and secreted (MelPRL) prolactin. The positive
influence of the secreted prolactin on the growth of host HF cells was
mentioned. The cells of this line were adapted to the suspension
cultivation. It was observed an approximately twofold increase of the
recombinant hormone production in suspension culture1 (both for the
intracellular and secretory prolactin forms) comparing with its
production in monolayer culture.

Additional attempts were made to provide conditions for the most
efficient prolactin expression: influence of MOI of infection and
postinfection time for cell harvesting on the levels of prolactin
expression was investigated. Combination of conditions, which provide
the maximum yield of the recombinant product were established: HF cell
suspension cultivation, infecting them with the MOI 1, harvesting
prolactin containing cells and medium after 48 hours post infection.

Under conditions used recombinant prolactin expression levels were
estimated as 500 mg/L and 20-30 mg/L for intracellular and secreted
prolactin forms respectively.

The recombinant protein purification methods were suggested. The use of
AcHisPRL for cell infection enable us to introduce simple quick and
easy purification method based on Talon metal affinity resin.

Two purification methods for intracellular protein were used:
purification using metall-affine chromatography under denaturing
conditions with the subsequent renaturing of recombinant protein;
prolactin denaturing with the subsequent renaturing and purification of
renatured protein using metall-affine chromatography under the native
conditions.

The heparin-affinity chromatography method was used for purification of
secreted prolactin.

95% of purity of recombinant protein was reached, the quantity of the
purified product was estimated as 60 mg of the intracellular protein per
1 L of medium and 10 mg of the secreted protein per 1 L of medium. It
was shown that approximately 50% of secreted prolactin was glycosylated.

The estimation of the activity of expressed protein was performed.
The biological activity of secreted and intracellular prolactin forms
testing by proliferation assay with Nb2 lymphoma cells and appeared to
be approximately equal and correspondented the biological activity of
commercial nonrecombinant original human prolactin, used as
control in Nb2 cells routinely appield for hormone estimation medical
tests.

Based on the performed research the method of expression and
purification of biologically active human prolactin was suggested. The
baculovirus expression system described here can be used for large-scale
producrion of bioactive recombinant human prolactin for scientific
purpose and for medical diagnosticum test systems.

Key words: baculovirus expresson system, recombinant prolactin.

PAGE \* Arabic 1

М 1 2 3

кДа

Похожие записи