Ядерна рибосомальна ДНК як засіб для вивчення родинних зв’язків серед рослин: Автореф. дис… канд. біол. наук / С.І. Комарницький, НАН України. Ін-т

IAOeIIIAEUeIA AEAAeAIIss IAOE OE?A?IE

IINOEOOO EEIOEIII? AIIEIAI? OA AAIAOE*II? IIAEAIA?I?

EIIA?IEOeUeEEE NAssOINEAA IAIPIAE*

OAeE: 577.113:633.71

ssAeA?IA ?EAINIIAEUeIA AeIE ssE CANIA AeEss AEA*AIIss ?IAeEIIEO
CA’ssCEIA NA?AAe ?INEEI

03.00.15 — AAIAOEEA

Aaoipaoapao

aeenapoaoei? ia caeiaoooy iaoeiaiai nooiaiy

eaiaeeaeaoa aiieiai/ieo iaoe

Ee?a — 1999

Aeenapoaoei?th ? poeiien.

?iaioa aeeiiaia o aiaeaeiei oeeoioiciieiai? oa eeioeiii? iiaeaiapi?
Iinoeoooo eeioeiii? aiieiai? oa aaiaoe/ii? iiaeaiapi? IAI Oepa?ie;
Aeaeiaepaee eaaipaoipi?, Eipieianueei Aioaii/ii Naaee, Eueth, Aiaeiy; oa
A?ioao oeaio??, ?aoaa?n Oi?aa?neoao, Iueth-A?aina?e, NOA.

Iaoeiaee eapiaiee: aeaaeaiie IAI Oepa?ie, ipioani? Aeaaa THpie
THpi?ae/,

aeepaeoip Iinoeoooo eeioeiii? aiieiai? oa aaiaoe/ii? iiaeaiapi? IAI
Oe?a?ie

Ioioeieii iiiiaioe: — aeieoip aiieiai/ieo iaoe, ipioani? Iaethoa
Noaiineaa Noaiineaaiae/

caa?aeoaa/ a?aeae?eii iieaeoey?ii? aaiaoeee Iinoeoooo iieaeoeypii?
aiieiai? IAI Oe?a?ie

— eaiaeeaeao a?ieia?/ieo iaoe Eaoaaa?ia Apeaipie Iao?iae/

noa?oee iaoeiaee ni?a?ia?oiee Oeaio?aeueiiai

?anioae?eainueeiai Aioai?/iiai Naaeo IAI Oe?a?ie

Ipiaiaeia onoaiiaa: Iinoeooo oiciieiai? pineei i aaiaoeee IAI Oe?a?ie,
i. Ee?a.

Caoeno aeena?oaoe?? aiaeaoaeaoueny » 27 » o?aaiy 199 9
pieo i 14 aiaeeii ia caniaeaiii niaoeiaeiciaaii? a/aii? paaee
Ae.26.202.01 o Iinoeoooi eeioeiii? aiieiai? oa aaiaoe/ii? iiaeaiapi? IAI
Oepa?ie ca aaepanith: 252143, Ee?a-143, aoe. aeaae. Caaieioiiai, 148.

C aeenapoaoei?th iiaeia iciaeiieoeny a aiaeiioaoei Iinoeoooo eeioeiii?
aiieiai? oa aaiaoe/ii? iiaeaiapi? IAI Oepa?ie ca aaepanith: 252143,
Ee?a-143, aoe. aeaae. Caaieioiiai, 148.

Aaoipaoapao picineaiee » 3 » ea?oiy 199 9 pieo.

A/aiee naepaoap Oapanaiei E.A.

niaoeiaeiciaaii? a/aii? paaee

CAAAEUeIA OA?AEOA?ENOEEA ?IAIOE

Opaaeeoeieia eeaneoieaoeiy pineei ia aiaeiiaiaeii eeane, iipyaeee,
piaeeie, piaee oa aeaee aei iaaeaaiueiai /ano iapaaaaeii aacoaaeany ia
ii?aeiaiii iipoieiai/ieo, oeeoieiai/ieo, aiioiii/ieo oa aeieiai/ieo
oapaeoapenoee. Nopiieee picaeoie iaoiaeia iieaeoeypii? aiieiai?, ciepaia
iieaeoeypii? aiapeaeecaoei?, eeiioaaiiy, panopeeoiiai aiaeico,
anoaiiaeaiiy iapaeiii? nopoeoope aieeia oa ioeea?iiaeo eeneio, noaipea
aaaaoi iiaeo caniaia aeey aeineiaeaeaiiy oieiaaiaoe/ieo ca’yceia. Ia
iieaeoeypiiio piaii iaeaieueo ooiaeaiaioaeueiei iipiaiyiiyi ?
niianoaaeaiiy iapaeiii? nopoeoope aiiieiai/ieo aaiia picieo iiioeyoeie
/e aeaeia. Iae/anoioa c oaeith iaoith aeeipenoiaothoue iineiaeiaiinoi ye
eiaeoth/eo, oae i iaeiaeoth/eo aeieyiie yaeapii? peainiiaeueii? AeIE
(Baldwin 1992).

Aeaee piaeeie ianeueiiiaeo iioepaii ia anio eiioeiaioao, ipioa iniiaia
?o /anoeia ? opiii/ieie. Aeayei c ieo iathoue aaaeeeaa
nieuenueei-ainiiaeapnueea cia/aiiy (Solanum, Lycopersicon, Capsicum),
aeei?enoi-aothoueny ye aeaeapaei iaaee/ieo ipaiapaoia (Atropa, Scopolia,
Datura, Duboisia) /e ye iiaeaeuei? nenoaie a aeineiaeao ii aiioaoiieiai?
pineei oa aaiaoe/ieo iaiiioeyoeiyo in vitro (Nicotiana). ?iae othothi ?
aeinoaiuei ipeiaaeiei ia’?eoii aeey anoaiiaeaiiy piaeeiieo ca’yceia o
iueiio, ineieueee ani no/anii aeaee Nicotiana ? ipepiaeiiie
iieiiei?aeaie (n=12 oa 24), aai ae aiaoiei?aeaie (n= 9, 10, 16-19,
21-23), (Goodspeed, 1954; Burbidge, 1960). Iepii oeueiai, a piaei
iniothoue aeaeieueea aeaeia, iiiapaae-ieee yeeo caciaee aaaaoueio
aiapeaeecaoeie a ipioeani naiai picaeoeo (N. glutinosa, N. glauca, N.
bigelovii, N. clevelandii, N. nudicaulis, N. africana, N. debneyi, N.
fragrans i N. suaveolens), ?o aaiethoeieia ieioea caeeoa?oueny
c’yniaaiei ia/ioei. Oaeiae napaae ipaaenoaaieeia piaeo ? ye ipepiaeii
(N. rustica, N. tabacum, N. arentsii), oae i ooo/ii aioiaeeiei?aee (N.
didebta, N. digluta), iiiapaaeieee yeeo aiaeiii c eioapaoope. Ca oaeeo
ianoaaei aiaeic ?o piaeeiieo ca’yceia aoaea aaaeeeaei epeoapi?i
aeinoiaipiinoi aeaiiai aeineiaeaeaiiy a iaaeao piaeo.

Aeooaeueiinoue oaie. Oe?iea iioe?aiiy p?IE a ipepiaei oa picaeoie
iaoiaeee oaeaeeiai aecia/aiiy iapaeiii? nopoeoope oeeo iieaeoe nipeyee
aeoeaiiio aeeipenoaiith p?IE aeey aeineiaeaeaiiy aaiethoeieieo ca’yceia
na?aae ?ineei. Iepii oiai, aeey oapaeoapenoeee oaeiai oaeniio, ye
Nicotiana, aeaee yeiai aeieeee a pacoeueoaoi /eneaiieo iiaeaeaeiaeo
aiapeaeecaoeie, iieiiipoici naia yaeapii? AeIE oi/iioa aiaeiapaaeaoeia
ipioean aaiethoei? piaeo (Olmstead and Palmer, 1991).

ssaeapii aaie, ui eiaeothoue p?IE, ipenooii a oeiiaiio pineeiiiio aaiiii
o aeaeyaei aeaeieueeio oeny/ eiiie (Appels and Honeycutt, 1986).
Aeipa/i, aiie iiaeooue aeoioethaaoe aei 10% pineeiiiai aaiiio (Hemleben
et al., 1988). ?eainiiaeueii ?IE ipaaiiciaaii a oaiaeaiii picoaoiaaii
iiaoipe, a iaaeao iaeiiai /e aeaeieueeio opiiiniiieo eieonia. Iaeaieueo
aecia/iith penith ipaaiicaoei? pAeIE ? caaaeueia iaeiipiaeiinoue anio
/eaiia aeaii? piaeeie aaiia, ineieueee aiie aaiethoeiiiothoue
ocaiaeaeaii (Arnheim, 1983). Eiaeai c oaeeo iiaoipia neeaaea?oueny c
aenieieiinapaaoeaii? /anoeie, ui opainepeao?oueny (ciaiioiie
opainepeaoth/ee niaenap, 18S pAeIE, aioopioiie opainepeaoth/ee niaenap
(AON), 5.8S oa 26S pAeIE), oa iiaeaaiiiai niaenapa (Long and David,
1980). Ia ani aeieyiee pAeIE aaiethoeiiiothoue c iaeiaeiaith
oaeaeeinoth, ioaea, a oie /an ye aeayei c ieo ipeaeaoii aeey iipiaiyiiy
ia piaiyo, ieae/eo ca piaeiaee, iioi, aianeiaeie nai?? aeniei?
eiinapaaoeaiinoi, aiaeiapaaeaoeiooue aaiethoeieii iiaei? ia piaii
piaeeie oa aeua. Ia nueiaiaeiioiie aeaiue pAeIE oniioii
aeeipen-oiao?oueny aeey anoaiiaeaiiy aaiaoe/ii? piciiiaiioiinoi /e
piaeeiieo ca’yceia napaae pineei, a oaeiae a ipiapaiao ii iopeiaiith
iiaeo nipoia pineei (Appels and Dvorak, 1982; Saghai-Marroof et al.,
1984; Doyle and Beachy, 1985; Jorgensen et al., 1987; Springer et al.,
1989; Guadet et al., 1989; Santoni and Berville, 1992; Borisjuk et al.,
1994; Cuellar et al., 1996).

Ipaaiicaoeiy iiaoipia pAeIE a iaaeao piaeo Nicotiana oa napaae aeaeia
piaeeie ianeueiiiaeo aea/aia iaaeinoaoiuei, a aeaii, iayaii a
eioapaoopi, opaaiaioapi?, ? ia ? aeineoue nenoaiaoe/ieie (Iepioie/aiei e
aep., 1989, Aipenthe e aep., 1989, Aieeia e aep., 1991). A aieueo
iaaeaaiio aeineiaeaeaiiyo (Borisjuk et al., 1994; Borisjuk et al., 1997)
ioiieaii oepoee niaeop aeaeia piaeeie ianeueiiiaeo. ?aeiinopoeiaaii
panopeeoii eapoe aeey aeae?eueeio panopeeoac 23 aeaeia piaeo Solanum, a
oaeiae iepaieo ipaaenoaaieeia Datura, Nicotiana, Physalis i Capsicum.
Iiaoipia aea/aiiy pAeIE iiaoipia N. tabacum, N. otophora, N.
tomentosiformis i N. sylvestris pacii c aea/aiiyi aeaeiniaoeeoi/ii?
aaiethoei? oaeiiapieo iiaoipia ipiaaaeaii Eiaapeeii oa iio. (Kovarik et
al., 1996).

Ca’ycie piaioe c iaoeiaeie ipiapaiaie, ieaiaie, oaiaie. ?iaioa aeeiiaia
a paieao oaie «Aea/aiiy iieaeoeypii-aiieiai/ieo oa aaiaoe/ieo ipioeania
a opainaaiieo eeioeiieo eiiiyo oa pineeiao» Iinoeoooo eeioeiii? aiieiai?
oa aaiaoe/ii? iiaeaiapi? IAIO; niieueiiai aeineiaeieoeueeiai ipiaeoo
«Iieaeoeypia oa opiiiniiia aaiethoeiy a piaeeii ianeueiiiaeo» iiae
Iinoeoooii eeioeiii? aiieiai? oa aaiaoe/ii? iiaeaiapi? IAIO oa
Aeaeiaepaee eaaipaoipi?th, Eipieianueei Aioaii/ii Naaee, Aiaeiy,
iiaeopeiaiiai Iiaeiapiaeiith anioeiaoei?th nipeyiiy niiapiaioieoeoao
a/aieo c epa?i aoaoiai ?aaeyinueeiai Nithco (INTAS-93-2540); oa
i?ia?aiith ?1-737 ?aoaa?n, Aea?aeaaiiai Oi?aa?neoaoo Iueth-Aeaea?n?,
NOA.

Iaoa oa caaaeaiiy aeineiaeaeaiiy. Iaoa aeaii? piaioe — paeiinopoeoeiy
piaeeiieo ca’yceia napaae aeaeia piaeo Nicotiana oa aeayeeo iioeo aeaeia
piaeeie ianeueiiiaeo ia iniiai nopoeoopii? ipaaiicaoei? peainiiaeueii?
AeIE oeeo oaeniiia.

Caaaeaiiy aeine?aeaeaiiy:

1. Ipiaanoe panopeeoia eapooaaiiy pAeIE 66 aeaeia piaeo Nicotiana.

2. Bea/eoe iioepaiiy noaiiaoipia c iiaeaaiiiai niaenapa N. tabacum ye a
iaaeao, oae i ca iaaeaie ae?eyiie pAeIE oeeo aeaeia.

3. Aecia/eoe iapaeiio nopoeoopo aioopioiueiai opainepeaoth/iai niaenapa
68 aeaeia piaeo Nicotiana oa 6 aeaeia piaeeie ianeueiiiaeo.

4. ?aeiinopothaaoe piaeeiii ca’ycee napaae aeineiaeaeoaaieo aeaeia oa
iipiaiyoe ?o c aeniiaeaie, iopeiaieie ia iniiai iipoieiai/ieo oa
oeeoiaaiaoe/ieo aeineiaeaeaiue.

Iaoeiaa iiaecia iopeiaieo pacoeueoaoia. Aeineiaeaeaii piaeeiii ca’ycee
napaae 68 aeaeia piaeo Nicotiana oa 6 iioeo ipaaenoaaieeia piaeeie
ianeueiiiaeo ia iniiai panopeeoiiai aiaeico ?o yaeapii? peainiiaeueiii?
AeIE; iioepaiiy noaiiaoipia c iiaeaaiiiai niaenapa N. tabacum ye a
iaaeao, oae i ca iaaeaie ae?eyiie pAeIE oeeo aeaeia; oa iapaeiii?
nopoeoope aioopioiueiai opainepeaiaaiiai niaenapa. Ipiaaaeaii ?o
iipiaiyiiy c aeaieie iipoieiai/ieo, oeeoiaaiaoe/ieo oa
iieaeoeypii-aiieiai/ieo aiaeicia. Caipiiiiiaaii iiiiaeaio noaio
?iaeeiieo ca’yceia a piaei Nicotiana. Aiapoa iiaoaeiaaii panopeeoii
eapoe iiaoipia pAeIE 56 aeaeia piaeo Nicotiana oa 6 iioeo aeaeia piaeeie
ianeueiiiaeo. Aiapoa aea/aii iioepaiiy noaiiaoipia c iiaeaaiiiai
niaenapa N. tabacum ye a iaaeao, oae i ca iaaeaie pAeIE aeineiaeaeoaaieo
aeaeia. Aiapoa aecia/aii iapaeiio nopoeoopo aioopioiueiai
opainepeaoth/iai niaenapa 68 aeaeia piaeo Nicotiana oa 6 aeaeia piaeeie
ianeueiiiaeo.

Ipaeoe/ia cia/aiiy iopeiaieo pacoeueoaoia. ?iaioa ipenay/aia no/aniiio
noaio aiaeico ?iaeeiieo ca’yce?a napaae pineei ia picieo oaeniiiii/ieo
piaiyo ia iniiai niianoaaeaiiy iineiaeiaiinoae peainiiaeueii? AeIE.
Iieacaia ipeaeaoiinoue canoinoaaiiy oeeo iineiaeiaiinoae aeey oaei?
paeiinopoeoei? napaae aeaeia piaeeie ianeueiiiaeo. Cpiaeaia nipiaa
ii?aeiaoe oieiaaiaoe/ii noaie aeey piaeo Nicotiana, iopeiaii ia iniiai
iipoieiai/ieo, oeeoiaaiaoe/ieo i iieaeoeypieo aeaieo.

Iopeiaii pacoeueoaoe iiaeooue aooe aeeipenoaii ipe iiaeaioiaoei
oaipaoe/iiai eopno «Iniiae eeanoa?iiai aiaeico» aeey nooaeaioia
oiiaapneoaoia oa nieuenueeiainiiaeapnueeeo aocia Oepa?ie, a paeoe/iie
naeaeoei? othothiia, a oaeiae a aeniapeiaioao ii niiaoe/iie
aiapeaeecaoei? ianeueiiiaeo.

Iniaenoee aianie caeiaoaa/a. Aeena?oaoe?eia ?iaioa ? caaa?oaiei iaoeiaei
aeine?aeaeaiiyi N.?. Eiia?ieoeueeiai. Aaoi? iinoaaea iaoo oa caaaeaiiy
iaoeiai? ?iaioe, iiaioaaa iaiao?aei? iaoiaeeee aeine?aeaeaiiy.
?ano?eeoia ea?ooaaiiy ?AeIE Nicotiana, oa aea/aiiy iioe?aiiy noaiiaoi??a
c i?aeaaiiiai niaena?a ?AeIE N. tabacum i?iaaaeai? iniaenoi aaoi?ii,
aeiyoie neeaaea? eeoa Naoca?i aeio-a?a?eaeecaoe?y, aeeiiaia ?acii c
Eiiapieoeueeei I. Ia?iaeo oi?aa?ai n?eaaino i?iaiaeeee ni?eueii c Eienii
A. Aiae?c ia?aeiii? no?oeoo?e aioo??oiueiai o?aine?eaiaaiiai niaena?a,
eiai noaoenoe/ia oa o?eiaaiaoe/ia ?ioa?i?eoaoe?y i?iaaaeai? aaoi?ii.
Ni?aaaoi?noai Ia?ieiiiiai A.A. a?aeca?eaeth? eiai
eiinoeueoaoeaii-oaoi?/io aeiiiiiao o i?iaaaeaii? aeine?aeaeaiue.
Aeeeaaeai? o aeena?oaoe?? ?aea?, iaoeia? aeniiaee oa iieiaeaiiy
noi?ioeueiaai? aaoi?ii naiino?eii.

Aipiaaoeiy pacoeueoaoia aeenapoaoei?. ?acoeueoaoe piaioe aeiiiaiaeaeeny
ia: 10-e uipi/iie conopi/i a Eieae Nipiia Oapaipi «Eapooaaiiy oa
naeaiioaaiiy aaiiio» (i. Eieae Nipiia Oapaip, opaaaiue 1997), Eiia?an?
ii in vitro a?ieia?? (i. Aaoeiaoii, /a?aaiue 1997), 5-iio iiaeiapiaeiiio
eiiapani ii iieaeoeypiie aiieiai? pineei (i. Niiaaiop, aapanaiue 1997),
8-e eiioapaioei? ?apiiaenueeeo nooaeaioia (i. Aapeii, aeiaoaiue 1997),
18-iio i?aeia?iaeiiio eiia?an? c aaiaoeee (i. Iae?i, na?iaiue 1998), a
oaeiae ia iaoeiaeo naiiiapao aiaeaeieo oeeoioiciieiai? i eeioeiii?
iiaeaiapi? Iinoeoooo eeioeiii? aiieiai? oa aaiaoe/ii? iiaeaiapi?,
eaoaaepe eeioeiii? aiieiai? oa aaiaoe/ii? iiaeaiapi? Ee?anueeiai
Oiiaapneoaoo iiaii Oapana Oaa/aiea, Aeaeiae?aee eaai?aoi???,
Ei?ie?anuee? aioai?/i? naaee (Aiae?y) oa A?ioao oeaio?o oi?aa?neoaoo
?aoaa?n (NOA).

Ioaeieaoei?. Ca iaoa??aeaie aeena?oaoe?? iioae?eiaaii 12 ae?oeiaaieo
i?aoeue, a oiio /ene? 7 — a noaooyo o iaoeiaeo aeo?iaeao. Oeeee
ioae?eaoe?e a?aecia/aiee i?ai?yie ?iai? Oa?ana Oaa/aiea Ee?anueeiai
Oi?aa?neoaoo ?iai? O. Oaa/aiea (1997) oa Iaoe?iiaeueii? Aeaaeai?? Iaoe
Oe?a?ie (1997).

Nopoeoopa oa ianya piaioe. Aeena?oaoe?y neeaaea?oueny c anooio, iaeyaeo
eioapaoope, iieno iaoapiaeia oa iaoiaeia aeineiaeaeaiiy, pacoeueoaoia
?iaioe oa ?o iaaiaipaiiy, aeniiaeia oa nieneo aeeipenoaieo e?oa?aoo?ieo
aeaeapae. Iiaiee ianya aeena?oaoe?? 143 noi??iee. ?enoiee (19),
oaaeeoe? (3) oa nienie aeei?enoaieo aeaea?ae (259) caeiathoue 36
noi??iie.

IAOA?IAEE OA IAOIAeE AeINEIAeAEAIUe

A piaioi aeeipenoiaoaaee pineeiiee iaoapiae 68 aeaeia piaeo Nicotiana,
yeee aepiuoaaany a noapeeueieo oiiaao ia napaaeiaeui (Murashige and
Scoog, 1962) /e a oaiee/ieo oiiaao caiaeii paeiiaiaeaoeie (Chaplin and
Burk, 1979). Naiaei eenoee paooa aeaeia piaeeie ianeueiiiaeo (Cestrum
parqui, Petunia axillaris, Hyoscyamus album, Lycium turcomanium, Atropa
belladonna, Mandragora species) iopeiaii c aepiuoaaieo o aiaeepeoiio
apoioi pineei, Eipieianueei Aioaii/ii Naaee, Aiaeiy.

Aeaeieaiiy caaaeueii? AeIE ipiaiaeeee ca aeaui iiaeeoieiaaiith
iaoiaeeeith Ioppay i Oiiiniia (Murray and Thompson, 1980). ?anopeeoiee
aiaepieic ipiaiaeeee a caaaeueiiio ia’?ii 50 iee. Opaaiaioe picaeieyee a
0.8% aaapiciiio aaei (Maniatis et al., 1989). sse iapeape
aeeipenoiaoaaee opaaiaioe AeIE oaaa eyiaaea iiney iapiaee panopeeoacith
HindIII. ?iciipe panopeeoieo opaaiaioia anoaiiaethaaee ca aeiiiiiaith
aeanii? ipiapaie GEL (aapniy 1.0). Iapaianaiiy panopeeoieo opaaiaioia
AeIE ipiaiaeeee eoaeiei niiniaii (Reed and Mann, 1985) c aeeipenoaiiyi
iaiapaiieo oieueopia «Oieo Eaeop» (Anoiiiy) ipioyaii ii/i.

Aeey aianaiiy paaeiiaeoeaii? iioee a ciiae aeeipenoiaoaaee paaeoeith
iie-opaineyoei? (Rigby et al., 1977) aai iaoiae picniyii? caopaaee
(Feinberg and Vogelstein, 1983). sse ipiae aeeipenoiaoaaee oae?
iineiaeiaiinoi yaeapii? peainiiaeueii? AeIE: pTa71, ui iinoeea iiaiee
iiaoip pAeIE ioaieoei (Gerlach and Bedbrook, 1979), pUL7, ui iinoeea 3′
eiiaoeue 25S pAeIE oeeopeie (Eieioa e Oiaeip, 1986), pNts-12, ui iinoeea
1-oii opaaiaio pAeIE c oeaiopaeueii? /anoeie i?aeaaiiiai niaena?a (IAN)
N. tabacum (Ai?enthe, iaiioae?eiaai? aeai?) oa pNt-4, ui iinoeea iiaiee
IAN N. tabacum (Borisjuk et al., 1997), ?en.1. Aeio-aiapeaeecaoeith
(Southern, 1975) ipiaiaeeee caiaeii (Church and Gilbert, 1984).

Aiieioieaoeith iineiaeiaiinoae aioopioiueiai opainepeaiaaiiai niaenapa
(AON) ipiaiaeeee ia DNA Thermal Cycler 480 c aeeipenoaiiyi ipaeiapia
«ITS5» oa «ITS4» (White et al., 1990), caiaeii (Baldwin, 1992). I/enoeo
aiieioieiaaieo opaaiaioia ipiaiaeeee ca aeiiiiiaith Wizard PCR Preps
System (Promega) caiaeii iaoiaeeee aepiaieea. ?aaeoeith oeeeei/iiai
nieaaino ipiaiaeeee ca aeiiiiiaith PRISM Ready Reaction DyeDeoxy
Terminator Kit (Perkin Elmer). Anoaiiaeaiiy iapaeiii? nopoeoope AON
ipiaiaeeee ia aaoiiaoe/iiio nieaiiaoipi ABI 377 DNA Sequencer (ABI).

Noaoenoe/io iapiaeo iopeiaieo iineiaeiaiinoae (iiaepaooiie aeiaaeeie oa
GC-aiinoo) ipiaiaeeee ca aeiiiiiaith aeanii? ipiapaie SEQAN (aapniy
2.0). Aepiaithaaiiy iineiaeiaiinoae ipiaiaeeee apo/io oa ca aeiiiiiaith
ipiapaie ClustalV (Higgins et al., 1992). Eeanoa?iee aiaeic ipiaiaeeee
iaoiaeaie «iaeaeeae/eo noniaeia» (neighbor-joining) oa «iaeneiaeueii?
aei-iiii?» (parsimony) ca aeiiiiiaith iaeaoa ipiapai aeey paeiinopoeoei?
oieiaaii? PHYLIP (aapniy 3.5), (Felsenstein, 1993).

?ACOEUeOAOE OA ?O IAAIAI?AIIss

?anopeeoia eapooaaiiy iiaoipia pAeIE aeaeia piaeo Nicotiana. Inio? aeaa
aieiaii iapaiaope, yei iiopiaii picoiioe, ipenooiath/e aei
oapaeoapenoeee oaei? nenoaie ye piaeeia ianeueiiiaeo, oa aeaee piaeo
Nicotiana ciepaia: aeiaaeeie iiaoipia peainiiaeueieo AeIE oeeo aeaeia oa
eieaeicaoeiy aapiaaaeueii? aeieyiee a iaaeao naiiai iiaoipo. Iipiaiyiiy
panopeeoieo eapo 66 aeaeia piaeo Nicotiana iieacaei, ui aeiaaeeie
iiaoipia pAeIE oeeo aeaeia ciiiththoueny a iaaeao aiae 8.5 aei 13.5 oii,
ca aeiyoeii N. noctiflora i N. petunioides, o yeeo aeiaaeeia pAeIE
iiaoipo nyaaea 19.0 oii. A oie /an ye aeaee iaeieo naeoeie iieacaee
aeineoue iacia/iee piaaiue aapiaoei? aeiaaeeie pAeIE iiaoipo
(iaipeeeaae, aeaee naeoei? Suaveolentes, 8.9 — 10.5 oii), ipaaenoaaieee
aeayeeo naeoeie cia/ii aiaepiciyeeny ca piciipaie iiaoipia pAeIE
(iaipeeeaae, aeaee naeoei? Tomentosae, 10.6 — 13.5 oii). Ia ciaeaeaii
aeiaeieo aiaeiiiiinoae a picoaooaaiii naeoia panopeeoei? aeey EcoRI,
BamHI, XbaI, DraI i EcoRV panopeeoac, a iaaeao iineiaeiaiinoae, ui
eiaeothoue 18S, 5.8S i 26S p?IE o aeaeia piaeo Nicotiana. Iieacaii, ui
peainiiaeueii iiaoipe aeineiaeaeaieo aeaeia piaeeie ianeueiiiaeo
aiaepiciythoueny ii aeiaaeeii ca paooiie aapiaaaeueiinoi ?o iaeiaeoth/eo
aeieyiie (pen. 2). Napaae aeineiaeaeoaaieo aeaeia piaeo Nicotiana 43
oapaeoapecoaaeeny ?aeeiei eeanii iiaoipia pAeIE, a niiaainioaaiiy aeaio
eeania pAeIE a aaiiii iaeiiai iiaeeaiaeoia niinoapiaaeiny o 22 aeaeia.
N. rustica aeyaeany ?aeeiei aeaeii, a aaiiii yeiai aoei aeyaeaii ope
picii ca aeiaaeeiith eeane pAeIE.

Iioepaiiy noaiiaoipia IAN N.tabacum. C iaoith aea/aiiy aiiieiai? iepaieo
aeieyiie IAN N. tabacum aei IAN iioeo piaeia piaeeie ianeueiiiaeo,
aeeipenoaii aeai aeenepaoii aeieyiee (VH i HB) ipiae pNt-4 oa ipiao
pNts-12 (?en.1), yeei aeanoeaa noaiiaoipia aoaeiaa. Ia anoaiiaeaii
aiiieiai? aei ipiae pNts-12 aeiaeiiai c IAN ipiaiaeiciaaieo aeaeia.
Noaiiaoipe ae, eieaeiciaaii a aeieyioei VH iieacaee aiiieiaith aei
aiaeiiaiaeieo aeieyiie IAN 6 ipiaiaeiciaaieo aeaeia, a noaiiaoipe HB —
oieueee 2 aeaeia.

R V H B X B V R

26S 18S 26S

IAN

pNt-4

pUL7 pNts-12

?en. 1. Noaiaoe/ia no?oeoo?a iiaoi?o ?AeIE N. tabacum. Iicia/aiiy: IAN —
i?aeaaiiee niaena?, R- EcoRI, V- EcoRV, H- HindIII, B- BamHI, X-XbaI
naeoe ?ano?eeoe??. Eieae?caoe?y i?ia pNt-4, pUL7 i pNts-12 iieacaia
iiaieie e?i?yie. A X B* R D V R*
B D B* R*R

18S ?AeIE 26S ?AeIE

1 oii

A oii

N. raimondii X VD D H B
10.8

N. tabacum V DD H B 10.7

D H B 9.6

N. repanda R R D D H B
9.4

D D H B
9.2

N. rustica R
V D DH B
10.2

V D DH B 9.9

1 oii
X D D H B
9.5

?en. 2. ?anopeeoii eapoe iiaoipia pAeIE aeayeeo aeaeia piaeo
Nicotiana. (A) ?icoaooaaiiy naeoia panopeeoei? a eiaeoth/eo
aeieyieao iaeiaeiaa. (A) ?anopeeii eapoe aeieyiee iiaeaaiiiai niaenapa
4 aeaeia. Aeaeiaa iacaa neipi/aia aei iapoeo opueio aoea. Nipaaa iiaeaii
piciipe iiaoipo pAeIE aeaiiai aeaeo a oii. R- EcoRI, V- EcoRV, H-
HindIII, B- BamHI, D- DraI, X- XbaI naeo ?ano?eeoe??. *anoeiai
iaoeeueiaaii naeoe iicia/aii cipi/eith.

CTGCGGAAGGTCATTGTCGAAACTGCAAAGCAGAACGACCCGCGAACTTGTTTAAAAACTAGGGAGCAGTAC
GATCGGGGTGCTTCGGCCTCCGTCCGTGCGGCTTCCTCCTATCCCCGGCGCGTGCGCTTGCGTGCGTGCTGG
GTGATTAACGAACCCCGGCGTGGAAAGCGCCAAGGAATACTAAATTGAAAGCCTGCCCTTCGCGCCCCGTTC
GCGGCGCGCGCGGGGGGACTTGTGCTTCTTTTGAAACACAAACGACTCTCGGCAACGGATATCTCGGCTCTC
GCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTT
GAACGCAAGTTGCGCCCGAAGCCACTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCC
GCACACCGCGCCCATACTCATGGCCGCGTTTGTGTCGTGGGACGGATACTGGCCTCCCGTGCGCCTCGAGCG
TGCGGTTGGCCTAAATGCGAGTCCACGTCGACGGACGTCACGACAAGTGGTGGTTGAAACTCAACTCTCGTA
ATGTCGCGGCTCCAACCCGTCGCATGTTTGGGCTCCCCGACCCTTATCGCGCTTAGGCGCTCCGACCG

?en. 3. Iineiaeiaiinoue AON N. longiflora. Iiaieie e?oa?aie aeae?eaia
iineiaeiaiinoue aaia 5.8S p?IE (i?aee?aneaii).

C iaoith aeineiaeeoe aeaeiniaoeeoi/iinoue aeieyiee IAN N. tabacum
(ipiaa pNts-12), caaaeueio AeIE aeaeia piaeo Nicotiana iapiaeyee
noiiooth EcoRI i BamHI panopeeoac oa aiapeaeecoaaee c ipiaaie pUL7 i
pNts-12. O aieueoinoi aeiaaeeia aiapeaeecaoeieii neaiaee, iopeiaii c
iaeaeaiia ipiaaie, iaee iaeiaeiao iioaineaiinoue. Ipioa conopi/aeeny i
aeiyoee. Ipiaa pNts-12 aeaaaea neeueiee aiapeaeecaoeieiee neaiae c AeIE
N. tomentosiformis, N. setchellii, N. kawakamii, N. otophora, N.
tomentosa, N. arentsii, N. undulata, N. palmeri, N. trigonophylla i N.
linearis. Iaaiaee, iineiaeiaiinoi IAN aeaeia N. longiflora (iaeei eean
?AeIE), N. plumbaginifolia, N. clevelandii (iaeei eean pAeIE), iieacaee
iaeaea noiaiaenioeiao aiaenooiinoue aiiieiai? aei oei?? ipiae. A
aeiaaeeao, eiee caaaeueia AeIE aeayeeo aeaeia iapiaeyeany noiith
panopeeoac EcoRI i BamHI oa aiapeaeecoaaeany c ipiaith pNts-12,
c’yaeyany iai/ieoaaiee opaaiaio piciipii 23 oii. Ianooiii aiapeaeecaoei?
c 18S /e 26S pAeIE ioaieoei ia aeaee aeiaeiiai iiiioiiai neaiaeo aei
oeueiai iaooapio. Oea icia/a?, ui opaaiaio 23 oii ia ? pacoeueoaoii
iaiiaiiai panopeeoiiai aiaepieico. Aieueo oiai, aeeipenoaiiy iioeo
panopeeoac (oaeeo, ye HindIII, EcoRV, XbaI i DraI) ipecaiaeeei aei
aiaeiai/iiai aoaeoo, ui aeaco? ia aiaenooiinoue aai iiaia iaoeethaaiiy
panopeeoieo naeoia iiciaaaiiy aeey aeaieo panopeeoac a iaaeao oei??
aeieyiee. Iiyao panopeeoiiai opaaiaioa piciipii 23 oii iiaeia iiynieoe
oieueee eiai iica-pAeIE eieaeicaoei?th, oiaoi iineiaeiaiinoi,
aiiieiai/ii aei noaiiaoipia aeieyiee IAN N. tabacum picoaoiaaii a iioeo,
ia-pAeIE, aeieyieao aaiiio iepaieo aeaeia. Iaoaiici aeieeiaiiy oaeeo
aeieyiie caeeoa?oueny iaaiaeiiei, aeayei ipeiouaiiy aoee i?eaaaeaii
paiioa (Unfried et al., 1991).

Aeeoapaioeieia aeaeiniaoeeoi/ia niipiaeiaiinoue noaiiaoipia c IAN N.
tabacum ye a iaaeao, oae i ca iaaeaie iiaoipia pAeIE iioeo othothiia
aeicaieeea cacepiooe a aaiethoeieia ieioea piaeo. Iapo ca ana,
iaiaoiaeii iinooethaaoe ipaaeaaiie ca’ycie iiae pre-Tabacum i
pre-Petunioides eiiieaenaie, aai ae iacaeaaeia aeieeiaiiy
aiapeaeecaoeieiiai opaaiaioa piciipii 23 oii o aeaeieueeio aeaeia
naeoei? Tomentosae, a oaeiae N. langsdorffii i N. acaulis. Aepoaa
ipeiouaiiy ? iaio eiiaipiei.

Caiaeii (Goodspeed, 1954), aeaee naeoei? Alatae pacii c aeaeaie naeoei?
Acuminatae aeaee ii/aoie aeaeai naeoei? Bigelovianae. Ineieueee inoaiii
iathoue uiiaeiaioa iaeei eean pAeIE c aiaenooiueith aiiieiai?th aei
noaiiaoipia IAN N. tabacum, iiaeia ipeionoeoe, ui oieueee iiiapaaeieee
N. plumbaginifolia /e N. longiflora (naeoeiy Alatae) iiaee aeeiiaoe oeth
pieue. Aieueo oiai, /eaie naeoeie Acuminatae, Alatae i Noctiflorae aoee
iiiapaaeieeaie no/anieo aanopaeienueeeo othothiia (naeoeiy
Suaveolentes). Ca ipeiouaiiyi (Goodspeed, 1954), N. suaveolentes (n=16),
N. debneyi i N. fragrans (iaeaeaa n=24) ? no/anieie oipiaie oeo
iiapaioia, ui aeinyaee Aanopaei? /apac opain-aioapeoe/iee iino, oiaei ye
paooa aanopaeienueeeo othothiia aeieeee aianeiaeie /eneaiieo
iiaeaeaeiaeo aiapeaeecaoeie inoaiiio. Oae ye iaeei c eeania pAeIE N.
suaveolens ia? ciaioaio eieueeinoue noaiiaoipia, aiiieiai/ieo aei oaeeo
N. tabacum, iiaeia ipeionoeoe, ui oieueee N. plumbaginifolia /e N.
longiflora (naeoeiy Alatae) iiaee aooe iapoei aaoueeianueeei aeaiaioii
aeey oeueiai aeaeo, oiaei ye aepoaei aoa iiiapaaeiee N. acaulis, ui
iinoea opaaiaio piciipii 23 oii (naeoeiy Noctiflorae). Iiiapaaeieee ae
N. noctiflora i N. petunioides (opaaiaio piciipii 23 oii o oeeo aeaeia
aiaenooiie) ca oaapaeaeaiiyi (Chen et al., 1976; Kung et al., 1982),
i/aaeaeii ? aeiiipaie oeipiieanoiiai aaiiio aanopaeienueeeo othothiia.
N. plumbaginifolia i N. longiflora aaaaeathoueny oaeiae iiaeeeaeie
iiiapaaeieeaie N. debneyi oa N. fragrans, ineieueee aiiieiaiy aei
noaiiaoipia N. tabacum iaeaea aiaenooiy a IAN pAeIE oeeo aeaeia. A naith
/apao, oieueee iiiapaaeieee N. corymbosa, N. miersii /e N. spegazzinii
(ia aiaeiiio aiae paooe aeaeia naeoei? Acuminatae) /apac ciaioaio
niipiaeiaiinoue ?o pAeIE aei noaiiaoipia IAN N. tabacum iiaee a aooe
aepoaei iiiapaaeieeii N. debneyi. ?aooa aanopaeienueeeo othothiia
iinoyoue opaaiaio 23 oii, i oiio iiaeiii picaeyaeaoeny ye oaei, ui
aeieeee a pacoeueoaoi aiapeaeecaoei? N. suaveolens c N. debneyi i N.
fragrans, ui noipiaiaeaeoaaeany /eneaiieie aaeepinaie oa iioapepinaie
iioiaeieo.

Aaiethoeiy iapaeiii? nopoeoope 5.8S pAeIE pineei. Caaaeueia aeiaaeeia
5.8S pAeIE aeineiaeaeoaaieo 32 aeaeia ciiithaaeany a aeineoue iaoepieeo
iaaeao. Oae, yeui aeey iioo, iaiipioi, aoaaepe oa niapaee oea /enei
noaiiaeei 157, 155, 161, 162 ii, oi aeey paooe aeaeia aiii ia aeoiaeeei
ca iaaei 163-166 ii. 5.8S pAeIE iapaaaaeii? aieueoinoi aeaeia iaea
aeiaaeeio 164 ii (?en. 3). Eiaoioeiaio aiaeiioaiiy eieueeinoi iiceoeie
aei caaaeueiiai /enea ipiaiaeiciaaieo oaeniiia noaiiaea 5,125.
Aiaeiiiiinoi (Nei, 1972) iiae eiaeieie aeaiia aeaeaie, ciaoiaeeeeny a
iaaeao aiae 0.6 (Festuca i Bromus) aei 23% (Mnium i Dubautia). Ipioean
aepiaithaaiiy iineiaeiaiinoae 5.8S pAeIE aeiaaaa 164 ioeeaioeaeieo
iiceoeie, ipe /iio 61 c ieo (40%) aeyaeeany aapiaaaeueiith, oiaoi
iinoeea oi/a a iaeio ciiio a aoaeue-yeie aapoeeaeueiie iiceoei?
ioeeaioeaeia. C-iiiiae ieo 37 (22.4%) ioeeaioeaeieo iiceoeie aoee
iioaioeieii oieiaaiaoe/ii-iioipiaoeaieie, oiaoi oaeeie, a yeeo
niinoapiaaeanue iaeiaeiaa caiiia /e aopaoa ioeeaioeaea iaeii/anii a
aeaio picieo aeaeao (Baldwin, 1992). Iapaaaaeath/a eieueeinoue
iioaioeieii oieiaaiaoe/ii-iioipiaoeaieo iiceoeie oyaei? aei opueio
aeenepaoieo aeieyiie iieaeoee: ?? ii/aoeo oa eiioey (iiceoei? 1-3 oa

20 Triticum
aestivum

17 Hordeum vulgarae

9 Secale cereale

7 Dactylis glomerata

14 Agropyron

29 Festuca moirei

33 Bromus tectorum

17 Avena longiglumis

25 Melica imperfecta

Orysa sativa

44 Dubautia arborea

48 Arnica mollis

25 23 Madia bolanderi

11 Populus deltoides

16 49 Arabidopsis thaliana

Sinapis alba

Cucumis melo

9
Lycopersicon esculentum

21 Vigna radiata

18 Lupinus luteus

9 3 Vicia faba

Atropa belladonna

7 14 Hyoscyamus albus

32 21 Lycium turcomanium

9 Petunia axillaris

9 17 Cestrum parqui

Mandragora sp.

47 Nicotiana plumbaginifolia

50 Ephedra kokamika

Picea excelsa

Marsilia quadrifolia

Mnium rugicum

?en. 4. Aaceipaiaaa aeapaai, caoaeiaaia ca iaoiaeii «iaeaeeae/eo
noniaeia» ia iniiai iapaeiii? nopoeoope 5.8S pAeIE 30 aeae?a ?ineei.
Iineiaeiaiinoue Mnium rugicum aeeipenoaii ye iieypecaoip.
Bootstrap-ioeiiee (iopeiaii c 50 bootstrap-iiaoipia), iieacaii eiei
eiaeii? aapoeie.

N.cordifolia (cor)

N.solanifolia (sol)

N.undulata (und)

N.knightiana (kni)

N.paniculata (pan)

N.rustica (rus)

N.raimondii (rai)

N.benavidesii (ben)

N.wigandioides (wig)

N.arentsii (are)

N.bigelovii (big)

N.trigonophylla (tri)

N.palmeri (pal)

N.otophora (oto)

N.tomentosa (tom)

N.tomentosiformis (tos)

N.setchelii (set)

N.kawakamii (kaw)

N.tabacum (tab)

N.digluta (dig)

Suaveolentes

N.didebta (did)

N.plumbaginifolia (plu)

N.longiflora (lon)

N.alata (ala)

N.langsdorffii (lan)

N.sanderae (san)

N.forgetiana (for)

N.bonariensis (bon)

N.attenuata (att)

N.pauciflora (pau)

N.corymbosa (coy)

N.acuminata (avu)

N.miersii (mie)

N.clevelandii (cle)

N.linearis (lin)

N.spegazzinii (spe)

N.acaulis (aca)

N.petunioides (pet)

N.noctiflora (noc)

N.glauca (gla)

N.nudicaulis (nud)

N.nesophila (nes)

N.stocktonii (sto)

N.repanda (rep)

N.sylvestris (syl)

N.glutinosa (glu)

Cestrum parqui

?en. 5. Eiinainonia aeapaai Nicotiana, iiaoaeiaaia ia iniiai
iineiaeia-iinoae AON oa iaoiaeo «iaeneiaeueii? aeiiiii?». Caeeoaia
oieueee aeaeiaa iacaa. Aeaee naeoe?? Suaveolentes neeaaeaee ?aeeiee
eeanoa? (i?aee?aneaii).

156-164) i iaeanoi iaoei «GC-aaaaoi?» oieeueee (iiceoei? 124-138), ia
aeieth oeeo aeieyiie ipeiaaea? 21 iioaioeieii oieiaaiaoe/ii-iioipiaoeaia
iiceoeiy, ui noaiiaeoue 56.8% aiae caaaeueiiai ?o /enea. A oiiieiai?
iopeiaiiai aeapaaa, caoaeiaaiiai iaoiaeii «iaeaeeae/eo noniaeia», iiaeia
aeaeieeoe aeaeieueea /ioei iepaneaieo apoi (?en. 4). Iaia? iiyeiai
noiiiao a picoaooaaiii aaciaeo aeaeia, ui oipiothoue iniiao aeapaaa. Oea
— eenoyiee iio, iaiipioue oa aeaa aieiianiiii aeaee- aoaaepa oa niapaea.
Eaioeiai pineeie a naith /apao oipiothoue ?aeeiee eeanoap, iiaeopeioth/e
aiiioaco ipi ?o iiiioieaoe/ia iioiaeaeaiiy (Oaooaaeaeyi, 1966). Eeanoap
iiepeoiianiiieo iiaeiey?ouey ia ope aieee. Iapoo c ieo neeaaeathoue
caeeaeaii iiae niaith ipaaenoaaieee piaeei Solanaceae i Fabaceae, ye
i a piaioi (Palmer,1985). ?aooa iiepeoiianiiieo aiaeianaii aei aeaio
apoi, iaeia c yeeo oipio?oueny ipaaenoaaieeaie aeeeth/ii iaeiiaeieueieo,
a iioa — aeaeaie piaeei Nucurbitaceae, Salicaceae i Brassicaceae oa
iaeaieueo aaiethoeieii ipinoiooeie aeaeaie piaeeie Asteraceae.

Eeanoa?iee aiaeic ia iniiai iineiaeiaiinoae AON. Iineiaeiaiinoi AON anio
aeaeia piaeo Nicotiana eaaei aepiaithaaeeny ye ia aeieyioei AON-1, oae i
ia aeieyioei AON-2. Aeiaaeeie oeeo aeieyiie noaiiaeee aiaeiiaiaeii aiae
248 aei 256 ii oa aiae 212 aei 228 ii (pen. 3). Aieueoinoue ciii ii
aeiaaeeii niinoapiaaeeny ca paooiie aapiaaaeueieo aeieyiie 1-50,
112-119, 240-260 o iineiaeiaiinoi AON-1 oa 127-137, 176-247 o
iineiaeiaiinoi AON-2. Iaeaieueoa aeaeaoeiy piciipii 10 ii niinoapiaaeany
ia aeieyioei AON-2 aeaeia N. noctiflora i N. petunioides. Anapaaeeii
piaeo aiaeiiiiinoi a iineiaeiaiinoi aeey eiiaiiiaaii? AON-1/5.8S/AON-2
iaopeoei aeaieo ciiithaaeeny a iaaeao aiae 0.005 aei 0.337 (napaaei?
cia/aiiy 0.188). A oeueiio aeineiaeaeaiii iopeiaii 51.4% aiaeiiiiinoue
iapaeiii? nopoeoope AON a iaaeao piaeeie. Aeiaaeeia iopeiaiiai
aepiaithaaiiy (pacii c iineiaeiaiinoth AON Cestrum parqui) noaiiaeea 663
ii, ipioa ca apaeii iiaeeeainoae ia/enethaaeueii? oaoiiee aeoiaeia
iaopeoey aeaieo aoea picaeoa ia aeai. Aeiaaeeia aepiaithaaiiy aeey oaeeo
iaopeoeue noaiiaeea 654 i 662 ii, aiaeiiaiaeii. Oiiieiaiy aaceipaiaaiai
aeapaaa, iopeiaiiai ca iaoiaeii «iaeneiaeueii? aeiiiii?» oa aeaieie
iapoi? iaopeoei, aoea ianooiiith. A iniiai aeapaaa eaaeaoue aeaa aeaee
naeoei? Alatae N.plumbaginifolia i N.longiflora. ?aooa 9-oe iapii aeaee
naeoei? oipiothoue ?aeeiee eeanoap. Aeaee naeoei? Acuminatae
piciiaeieaii ia aeaa eeanoape, iaeei c yeeo (N. spegazzinii i N.
linearis) ? oieiaaiaoe/ii aeecueeei aei aeaeo naeoei? Noctiflorae N.
acaulis. Oei aeaee ? aenieiniaoeiaeiciaaieie a naeoei?, ipi ui
naiae/eoue ?o aaiii (1m+2sm+8st) (Goodspeed, 1954), ciaioaia eieueeinoue
AeIE (Narayan, 1987), a oaeiae aiaenooiinoue opeoiiia ci
niaoeiaeiciaaiith noiaaopiaith eeioeiith, aeanoeaith anii iioei
aeaeai naeoei? (Goodspeed, 1954). ?o aeeceinoue aei N. acaulis iiaeia
iiynieoe aipeciioaeueiei iapaiinii

TOMENTOSAE

PRE- oto GENUINAE

TABACUM kaw tab

tom

set

glu

tos

PANICULATAE

ben sol cor RUSTICAE

kni rai pan rus

PRE- gla

RUSTICA

UNDULATAE

und REPANDAE

are rep sto nes

PRE- wig

NICOTIANA

CESTRUM TRIGONOPHYLLAE

PETUNIA pal BIGELOVIANAE

tri big

cle

ACUMINATAE

acu att NUDICAULES

PRE- mie pau coy nud

PETUNIOIDES

lin spe SUAVEOLENTES

umb vel

NOCTIFLORAE deb amp bet

pet noc aca cav eas

fra exc exi

ALATAE goo gos

lan sua hes ing

ala for san bon mar meg

plu lon afr occ ros

syl rot sim

?en. 5. Iioiaeaeaiiy, aaiethoeiy oa piaeeiii ca’ycee 66 aeaeia piaeo
Nicotiana ia iniiai iipoieiai/ieo aeaieo (Goodspeed, 1954), oa aeaieo
iioepaiiy noaiiaoipia IAN i iapaeiii? nopoeoope AON. Ia?a?aiith e?i??th
aeacai? ?iaeeii? ca’ycee, ooi/iai? a aeai?e ?iaio?.

aaiaoe/iiai iaoapiaeo, ineieueee apaaee ?o inioaaiiy iapaepeaathoueny.
?iciiaeie aanopaeienueeeo aeaeia ii eeanoapai aeaui ia niiaiaaea? c
oaeei, caipiiiiiaaiei ia iniiai iipoieiai/ieo iciae ?o ianiiiy (Bahadur
and Ferooqui, 1986), ipioa aeiapa ocaiaeaeo?oueny c no/aniith
oaeniiiii?th (Goodspeed, 1954; Burbidge, 1960; Chen et al., 1976), (ia
iieacaii). Iaeaeeae/ei aei Cestrum aeaeii a oiiieiai? aepoaiai aeapaaa
aeyaeany N. glutinosa. sse aoei anoaiiaeaii paiioa (Goodspeed, 1954),
ani no/anii aeaee naeoei? Paniculatae ca aeiyoeii N. glauca oa aeaee
naeoei? Tomentosae iioiaeyoue aiae 6-e iapieo pan a iaaeao
oeanopi?aeiiai eiiieaeno. Aiaeiai/ii, iaeia /e aeaeieueea 6-e iapieo
pan aeaee iiooiao aei ooaipaiiy iapaaaaeii? aieueoinoi aeaeia iiaepiaeo
Petunioides. Aeeoapaioeiaoeiy, ui noipiaiaeaeoaaea ipioean aioiieiiaei?,
aeaea ii/aoie aei-iiaepiaeiaei eiiieaenai 12-e iapieo pan, napaae yeeo i
ciaoiaeeeeny iaeaooii iiiapaaeieee anio no/anieo aeaeia 12-e iapiiai
piaiy (ca aeiyoeii aeaeia naeoeie Undulatae i Trigonophyllae). A
aioiaeeiei?aeiiio iioiaeaeaiith aeaio inoaiiio naeoeie apaee o/anoue 6-e
iapii pane ye oeanopi?aeiiai, oae i iaooiiiiaeiiai eiiieaenia. Oiio ia
aeieea? noiiiao iiaeie aeaeia iiaepiaeia Rustica i Tabacum ia aeaa
eeanoape. Ocaaaeueiaia no?oeoo?a ?iaeeiieo ca’yce?a a ?iae? Nicotiana ia
iniia? ia?aeiii? no?oeoo?e AON iieacaia ia pen. 5.

Iiaeaiaey/e iiaenoiie iaaiaipaiith iopeiaieo pacoeueoaoia, iiaeia
caipiiiioaaoe ianooiio oieiaaiaoe/io noaio piaeeiieo ca’yceia a piaei
Nicotiana, yea aaco?oueny ia ii?aeiaiii iipoieiai/ieo i oeeoiaaiaoe/ieo
aeaieo (Goodspeed, 1954) oa aeaieo nopoeoopii? ipaaiicaoei? iiaoipia
pAeIE i iineiaeiaiinoi AON oeeo aeaeia (pen. 6).

AENIIAEE

1. Iiaoaeiaaii panopeeoii eapoe aeey oa?iaio?a panopeeoe?? BamHI, DraI,
EcoRI, EcoRV, HindIII ? XbaI iiaoipia peainiiaeueii? AeIE aeaeia piaeo
Nicotiana. Iieacaii, ui peainiiaeueii iiaoipe aeineiaeaeaieo aeaeia
aa?’ththoue ii aeiaaeeii (8.5 — 19.0 oii) ca paooiie aapiaaaeueiinoi ?o
iaeiaeoth/eo aeieyiie.

2. Aeine?aeaeaii aiiieia?th noaiiaoi??a i?aeaaiiiai niaena?a ?AeIE
Nicotiana tabacum aei ae?eyiie i?aeaaiieo niaena??a ?AeIE ?aooa aeae?a
?iaeo. Anoaiiaeaii, ui oieueee iiiapaaeiee N. plumbaginifolia /e N.
longiflora iia aooe aeiiipii /anoeie yaeapiiai aaiiio aeae?a naeoe?e
Suaveolentes ? Bigelovianae.

3. A ?acoeueoao? aeine?aeaeaiiy noaiiaoi??a i?aeaaiiiai niaena?a ?AeIE
N. tabacum iieacaia ?o eieae?caoe?y a ?ioeo, ia-pAeIE ae?eyieao aaiiio o
25 aeae?a ?iaeo. Anoaiiaeaii, ui aanopaeienueei aeaee Nicotiana (ca
aeiyoeii N. debneyi i N. fragrans) oniaaeeoaaee ?o aiae iiiapaaeieea N.
acaulis.

4. Aecia/aii iapaeiio nopoeoopo aaia 5.8S p?IE ianeueiiiaeo, oa
ipiaaaeaii ?? iipiaiyiiy c oaeith 25 ieae/eo i aeueo pineei. Iieacaii
iiaia ocaiaeaeaiiy io?eiaieo aeaieo c caaaeueiii?eiyoeie a?iioacaie
?iaeeiieo ca’yce?a na?aae ?ineei, oi/a bootstrap-ioe?iee na?ae/aoue i?i
iaaeinoaoith noaoenoe/io i?aeo?eieo ie?aieo aa?oei aea?aaa.

5. Iieacaii, ui ?iaeeii? ca’ycee oaenii?a Nicotiana, ?aeiino?oeiaai? ia
iniia? i?ine?aeiaiino? aioo??oiueiai o?aine?eaiaaiiai niaena?a ?AeIE,
caaaeii ocaiaeaeothoueny c aeniiaeaie ii nenoaiaoeoe? ? o?eiaai?? ?iaeo,
noi?ioeueiaaieie ia iniia? eeane/ii? oaeniiii??, ca aeiyoeii oaeeo
aeae?a ye N. glutinosa, N. glauca, N. bigelovii, N. sylvestris
aaiethoe?eia ieioea yeeo aoei ooi/iaia.

NIENIE I?AOeUe,

IIOAEIEIAAIEO CA OAIITH AeENA?OAOeI?

1. Eiiapieoeueeee I.E., Eiiapieoeueeee N.?. Iieiiipoici aeiaaeei
panopeeoieo opaaiaioia iiaeaaiiiai niaenapa peainiiaeueii? AeIE aeayeeo
aeaeia othothio // Oeeoieiaiy i aaiaoeea. -1996. — 30, N 1. -C. 65-72.

2. Eiiapieoeueeee I.E., Eiiapieoeueeee N.?. Aapiaaaeueiinoue iiaeaaiiiai
niaenapa peainiiaeueieo AeIE aiapeeainueeeo aeaeia othothio //
Oeeoieiaiy i aaiaoeea. -1997. — 31, N 2. -C. 29-36.

3. Eiiapieoeueeee N.?. Ii??aiyeueiee aiae?c ioeeaioeaeieo
iine?aeia-iinoae 5.8S yaea?ii? peainiiaeueii? AeIE 30 aeae?a ?ineei //
A?iiie?ia?e ? ee?oeia. -1997. -13, N 2. -N. 150-156.

4. Eiia?ieoeueeee N.?., Eiia?ieoeueeee ?.E., Eien A., Ia?ieiiiee A.A.
Aa??aaaeuei?noue 5.8S ?AeIE o aeayeeo aeae?a ?iaeeie Solanaceaa //
Oeeoieia?y ? aaiaoeea. -1997. -31, N 5. -N. 16-32.

5. Eiia?ieoeeee N.E., Eiia?ieoeeee E.E, Eien A., Ia?ieiiiee A. A.
Iieaeoey?iay oeeiaaiey yaea?ieo aaiia 5.8S ?eainiiaeueiie AeIE 37 aeaeia
?iaea Nicotiana // Aaiaoeea (?inney). -1998. -34, N 6. -C. 883-889.

6. Eiia?ieoeueeee N.?. Ii??aiyeueiee aiae?c ia?aeiii? no?oeoo?e 5.8S
?AeIE ?ineei // Aeiiia?ae? IAI Oe?a?ie. -1998. -1. -N. 190-193.

7. Eiia?ieoeueeee N.?., Eiia?ieoeueeee ?.E., Eien A., Ia?ieiiiee A.A.
Aaiethoe?y iine?aeiaiinoae aioo??oiueiai o?aine?eaiaaiiai niaena?a
yaea?ii? ?eainiiaeueii? AeIE aia?eeainueeeo aeae?a ?iaeo Nicotiana. //
Oeeoieia?y ? aaiaoeea. -1998. -32, N 3. -C. 69-76.

8. Komarnitsky S., Komarnitsky I., Cox A., Parokonny A. Molecular
phylogeny of the genus Nicotiana (Solanaceae) based on the internal
transcribed spacer region of the nuclear ribosomal DNA // Abstracts of
the «Genome Mapping and Sequencing” Meeting. -Cold Spring Harbor (USA).
-1997. -P. 118.

9. Komarnitsky S. Nuclear ribosomal DNA repeat unit polymorphism and
the evolution of Nicotiana species // Abstracts of the Congress on In
Vitro Biology. -Washington (USA). -1997. -P. 136.

10. Komarnitsky S., Komarnitsky I., Cox A., Parokonny A., Gleba Yu.
Molecular phylogeny of the genus Nicotiana (Solanaceae) based on
studiing of nuclear ribosomal DNA sequences // Proceedings of the 5th
International Congress of Plant Molecular Biology. -Singapure
(Singapure).-1997. -P. 1109.

11. Komarnitsky S. Molecular phylogeny of the Solanaceae, an important
source of medical alkaloids, based on nuclear ribosomal DNA (internal
transcribed spacer) sequences // Proceedings of the 8th European Student
Conference. -Berlin (Germany). -1997. -P. 12.

12. Komarnytsky S., Komarnytsky I., Cox A., Parokonny A., Gleba Yu.
Nuclear ribosomal DNA from Solanaceae: strycture organization and
phylogenetic implications // Abstracts of the 18th International
Congress of Genetics. -Beijing (China). -1998. -P. 47.

Eiiapieoeueeee N.I. ssaea?ia ?eainiiaeueia AeIE ye cania aeey aea/aiiy
?iaeeiieo ca’yceia na?aae ?ineei . -?oeiien.

Aeenapoaoeiy ia caeiaoooy iaoeiaiai nooiaiy eaiaeeaeaoa aiieiai/ieo iaoe
ca niaoeiaeueiinoth 03.00.15- aaiaoeea.- Iinoeooo eeioeiii? aiieiai? oa
aaiaoe/ii? iiaeaiapi? IAI Oepa?ie, Ee?a, 1999.

Iiaoaeiaaii panopeeoii eapoe peainiiaeueieo iiaoipia 66 aeaeia piaeo
Nicotiana oa aea/aia aiiieiaiy aeaeieueeio aeieyiie iiaeaaiiiai niaenapa
Nicotiana tabacum aei iineiaeiaiinoae IAN oa ia-pAeIE iineiaeiaiinoae
oeeo aeaeia. Anoaiiaeaia iineiaeiaiinoue aioopioiueiai opainepeaiaaiiai
niaenapa 68 aeaeia Nicotiana oa 6 iioeo aeaeia piaeeie ianeueiiiaeo,
ipiaaaeaii eeanoa?iee aiaeic ia ?? iniiai. Caipiiiiiaaia ocaeaeueiaia
oieiaaiaoe/ia noaia piaeeiieo ca’yceia napaae aeaeia piaeo Nicotiana.

Eeth/iai neiaa: pAeIE, panopeeoia eapooaaiiy, aioopioiie opainepeaiaaiee
niaenap, Nicotiana, eeanoa?iee aiaeic.

Eiiapieoeeee N.E. ssaea?iay ?eainiiaeueiay AeIE eae n?aaenoai aeey
eco/aiey ?iaenoaaiiuo naycae n?aaee ?anoaiee. -?oeiienue.

Aeennapoaoeey ia nieneaiea o/aiie noaiaie eaiaeeaeaoa aeieiae/aneeo iaoe
ii niaoeeaeueiinoe 03.00.15 — aaiaoeea, Einoeooo eeaoi/iie aeieiaee e
aaiaoe/aneie eiaeaiapee IAI Oepaeiu, Eeaa, 1999.

Iinopiaiu panopeeoiua eapou peainiiaeueiuo iiaoipia 66 aeaeia piaea
Nicotiana e eco/aia aiiieiaey ianeieueeeo o/anoeia iaaeaaiiiai niaenapa
Nicotiana tabacum e iineaaeiaaoaeueiinoyi IAN e ia-pAeIE
iineaaeiaaoaeueiinoyi yoeo aeaeia. Onoaiiaeaia iineaaeiaaoaeueiinoue
aioopaiiaai opainepeaepoaiiai niaenapa 68 aeaeia Nicotiana e 6 aepoaeo
aeaeia naiaenoaa ianeaiiauo, ipiaaaeai eeanoa?iue aiaeec ia aa iniiaa.
Ipaaeeiaeaia iaiauaiiay oeeiaaiaoe/aneay noaia piaenoaaiiuo naycae
npaaee aeaeia piaea Nicotiana.

Eeth/aaua neiaa: pAeIE, panopeeoiia eapoepiaaiea, aioopaiiee
opainepeaepoaiue niaenap, Nicotiana, eeanoa?iue aiaeec.

Komarnytsky S.I. Nuclear ribosomal DNA as a tool for plant phylogeny
reconstruction. -Manuscript.

Thesis for a candidate’s degree by specialty 03.00.15 — genetics.
-Institute of Cell Biology and Genetic Engineering of National Academy
of Sciences of Ukraine, Kyiv, 1999.

Nuclear ribosomal DNA (rDNA) sequences are ubiquitous throughout nature
and possess several valuable characteristics for evolutionary
reconstruction. These genes are organized at one or few clusters of
tandem repeats, contain both highly conserved and variable regions, and
primarily evolve by the means of point mutations. Ribosomal RNA genes
are present in high copy number in plant genomes, making their
investigation relatively easy, low-cost and time-effective. These
considerations promoted broad and successful use of rDNA sequences to
investigate genetic diversity or phylogeny reconstruction within the
plant kingdom, as well as becoming a valuable marker in many plant
breeding programs. However, structural organization of rRNA genes among
the species of Solanaceae family, was studies very fragmentarily. Until
this paper came out, there were few rDNA phylogeny reconstruction
publications involved only several representatives of the family,
neither genus of the Solanaceae family in whole was subject to such type
of the analysis. Moreover, the genus Nicotiana appeared to be an
challenging but especially informative model for evolutionary
reconstruction, it comprises species of several polyploid and aneuploid
levels, as well as synthetic amphidiploids which progenitors are well
known from literature. This allowed the estimation of the phylogenetic
analysis accuracy.

In this study we show that rDNA sequences are a useful phylogenetic tool
for plant relationship reconstruction within the Solanaceae family. We
analyzed the organization of the nuclear-encoded ribosomal RNA genes
from 66 species of the genus Nicotiana and 18 other species of
Solanaceae by restriction enzyme mapping (BamHI, DraI, EcoRI, EcoRV,
HindIII, and XbaI restriction enzymes) using different rDNA specific
hybridization probes. We found no difference in the position of
restriction enzyme sites within the sequences coding for 18S, 5.8S, and
26S rRNAs, confirming their highly conservative structure. In order to
investigate homology at non-transcribed intergenic spacer (IGS) region,
we conducted Southern hybridization analysis using Nicotiana tabacum IGS
subrepeats as a probe. We showed that these subrepeats are located in
different number among the Nicotianas, moreover, they were identified in
other, non-rDNA regions of several Nicotiana species, but not other
Solanaceae representatives. It was suggested that only N.
plumbaginifolia or N. longiflora ancestors could be the partial donors
nuclear genomes of the species of Suaveolentes and Bigelovianae sections
of the subgenus Petunioides. All the Australian species of Suaveolentes
section (except for N. debneyi and N. fragrans) inherited non-rDNA
sequences from the species close to modern N. acaulis from the
South-American section of Noctiflorae.

To access relationship reconstruction data at different taxonomic
levels, we sequenced rDNA internal transcribed region (ITS) consisting
of two variable non-coding ITS1 and ITS2 regions split by especially
conserved region coding for 5.8S rRNA. They varied in length from 248 to
256 (ITS1) and from 212 to 228 bp (ITS2) while sequence coding for 5.8S
appeared to be predominantly uniform within the genus Nicotiana (164
bp). Sequence divergence leveled up to 20% between the moss and tobacco
5.8S rDNAs. Contrary, within the genus divergence resulted in 0.004 to
0.422 (mean 0.196) and 0.000 to 0.438 (mean 0.232) for ITS1 and ITS2
regions, respectively, but did not surpass 0.050 level for 5.8S rDNA.

These sequences were analyzed by parsimony and neighbor-joining distance
methods. First, we generated the phylogenetic tree among 30 plant
species of mosses, ferns, gymnosperms, and 7 families of angiosperms
based on the conservative 5.8S rDNA sequences. All the branches
representing sister taxa diverged in succession confirming its
suitability for phylogenetic resolution at the level of family and
above. However, the number of phylogenetically informative positions
within the gene itself was not enough for studying relationships within
the genus. Next, we used ITS regions to reconstruct the evolution of
rDNA sequences in the genus Nicotiana. All three subgenera of the genus
were shown to occupy a separate cluster, and 13 out of 14 sections of
the genus Nicotiana investigated, diverged successfully within them.

Combined analysis of restriction enzyme mapping and sequence comparison
data resulted in reconstruction of generalized phylogenetic scheme for
the genus Nicotiana where several previously questioned or uncertain
branches were successfully resolved. Overall, the phylogenetic
relationships established within the genus Nicotiana as well as among
the Solanaceae species were highly concordant with other molecular and
morphocytogenetical evidences published earlier.

Key words: ribosomal DNA, restriction mapping, internal transcribed
spacer, Nicotiana, cluster analysis.

Добавить комментарий

Ваш e-mail не будет опубликован. Обязательные поля помечены *