Молекулярно-біологічне вивчення геномних і реплікативних рнк фіто- та міковірусів як основа для створення рослинних біотехнологій (автореферат)

НАЦІОНАЛЬНА АКАДЕМІЯ НАУК УКРАЇНИ

ІНСТИТУТ МІКРОБІОЛОГІЇ І ВІРУСОЛОГІЇ

ІМ. Д.К. ЗАБОЛОТНОГО

МЕЛЬНИЧУК МАКСИМ ДМИТРОВИЧ

УДК 578.864:577.53.082

Молекулярно-біологічне вивчення геномних і реплікативних рнк фіто- та
міковірусів як основа для створення рослинних біотехнологій

03.00.06 – вірусологія

03.00.20 – біотехнологія

АВТОРЕФЕРАТ

дисертації на здобуття наукового ступеня

доктора біологічних наук

Київ 2006

Дисертацією є рукопис

Робота виконана на кафедрі екобіотехнології та біорізноманіття
Національного аграрного університету Кабінету Міністрів України

Науковий консультант: доктор біологічних наук, професор, академік УААН

Бойко Анатолій Леонідович,
Київський

національний університет
імені Тараса Шевченка,

професор кафедри
вірусології

Офіційні опоненти: доктор біологічних наук, старший
науковий співробітник

Щербатенко Іван
Степанович, Інститут мікробіології і

вірусології ім. Д.К.
Заболотного НАН України, завідувач

відділу
фітопатогенних вірусів

доктор біологічних наук, професор Стародуб Микола Федорович, Інститут
біохімії ім. О.В. Палладіна НАН України, завідувач відділу сенсорних та
регуляторних систем

доктор біологічних наук,
професор Радавський Юрій Леонідович, Інститут біоорганічної хімії та
нафтохімії НАН України, завідувач відділу структури та функції білків та
пептидів

Провідна установа: Національний медичний університет імені

О.О. Богомольця МОЗ України, м.
Київ

Захист дисертації відбудеться 17 травня 2006 р. о 10 годині на засіданні
спеціалізованої вченої ради Д 26.233.01 Інституту мікробіології і
вірусології ім. Д.К. Заболотного НАН України за адресою: Д 03680, м.
Київ, ДСП, вул. Заболотного, 154.

З дисертацією можна ознайомитись у бібліотеці Інституту мікробіології і
вірусології ім. Д.К. Заболотного НАН України за адресою: Д 03680, м.
Київ, ДСП, вул. Заболотного, 154.

Автореферат розіслано “14” квітня 2006 року

Вчений секретар

спеціалізованої вченої ради,

кандидат біологічних наук
Пуріш Л.М.

ЗАГАЛЬНА ХАРАКТЕРИСТИКА РОБОТИ

Актуальність проблеми. Геноми фіто- і міковірусів із дволанцюговими
геномними РНК (длРНК) — унікальні й високопрактичні моделі для
фундаментальної основи пізнання принципів будови, функціонування,
практичного використання, розробки експрес-діагностикумів, синтезу
специфічних молекулярних праймерів, створення банків вірусних генів,
біотехнологічного оздоровлення рослин, пізнання принципів, а також
законів еволюції та екології вірусів. Такими властивостями відзначаються
і фітовіруси із одноланцюговими РНК, які на стадії реплікації утворюють
специфічні длРНК [Valverde, 1990; Van der Lende, 1995; Zhou, 1998;
Osaki, 2002].

За останні двадцять років вивчення структури геному і можливість
одночасного існування фіто- та міковірусних представників царства Vira
на рослині-господарі практично не було досліджено. При цьому не рідко
навіть не визначався видовий склад мікроміцетів рослин і не перевірялось
інфікування останніх вірусами мікроскопічних грибів. Із-за подібних
порушень первинної вірусної діагностики і технологій ведення
господарювання в агроценозах останнє безперечно призводить до зниження
врожайності та погіршення якості продукції рослинництва [Бойко, 1990;
Тavantzis, 1994; Поліщук, 1998].

На сьогодні в зв’язку із бурхливим розвитком біотехнологій вивчаються
трофічні зв’язки вірусів в біогеоценозі, розробляються підходи щодо
отримання біотехнологічними методами оздоровлених від вірусів культурних
рослин, нових гібридів і сортів рослин із природною й штучною
резистентністю до вірусів, цінним морфогенетичним потенціалом та якістю
[Митрофанова, 1997; Кунах, 2001]. Значної уваги науковців світу
привертають також питання із діагностики, ідентифікації і кількісного
визначення наявності трансгенів в продукції, дотримання біоетики та норм
екобіобезпеки при проведенні біотехнологічних досліджень. Вивчення
фундаментальних основ функціонування, діагностики і ідентифікації
вірусів рослин й грибів являється запорукою успіху сучасних
біотехнологій підвищення кількості, якості та безпеки рослинницької
продукції. Особливо це стосується впровадження трансгенних технологій в
практику [Новожилов, Блюм, 2001; Messeguer, 2003; Ugozzoli, 2003; Heim,
2004].

Адже дані дослідження дволанцюгових форм РНК відкривають шлях до
виявлення моно- і змішаних фіто- й міковірозів, з’ясування природи
криптичних (латентних) вірусів рослин, уточнення систематичного
положення та класифікації відомих, а також раніше не описаних вірусів,
вирішення проблем з експрес-діагностики генетично-модифікованої
продукції, впровадження у практику безвірусного насінництва, а також
оздоровлених методами біотехнології промислових культур в цілому.

Зв’язок роботи з науковими програмами, планами, темами. Основні
експериментальні дослідження з дисертаційної роботи виконано у
проблемній лабораторії фітовірусології та біотехнології Національного
аграрного університету України (НАУ) в рамках науково-технічних програм
за темами: № 110/55А-ПЛ “Наукове обгрунтування та дослідження
ефективності біотехнологічних методів для використання в клітинній
біології та селекції” (№ державної реєстрації 0198U004095), № 110/34 ПЛ
“Вивчення механізмів взаємодії фітовірусів із клітинами та розробка
методів діагностики вірозів і отримання безвірусних рослин” (№ державної
реєстрації 0198 U 004073). Із 2002 р. по теперішній час робота
продовжується за науковими темами: №110/11Ф “Розробка технологій
мікроклонального розмноження цінних сільськогосподарських, технічних та
декоративних культур біотехнологічними методами та ДНК паспортизація
сортів рослин” (№ державної реєстрації 0043706 0103U004745) та 110/7Ф
“Розробка вітчизняних молекулярно-біологічних діагностичних систем для
виявлення латентних вірусів і трансгенів з метою отримання
генетично-модифікованих рослин та їх клонування на безвірусній основі”
(№ державної реєстрації 00493706 0103U005653).

Мета і задачі дослідження. Мета роботи — відпрацювати і впровадити в
Україні систему вірусологічних біотехнологій для ідентифікації фіто- і
міковірусів та оздоровлення рослин від вірусів.

Відповідно до поставленої мети передбачалось вирішення наступних задач:

1. Відпрацювати і вдосконалити існуючу методику виділення й очистки
длРНК з рослин та грибів шляхом хроматографії в градієнті целюлози.

2. Оптимізувати методи виділення і очистки длРНК міковірусів та
реплікативних РНК фітовірусів із рослин картоплі, перцю, хмелю, цукрових
буряків.

3. Розробити тест-систему для виявлення трансгенних сортів картоплі,
стійких до колорадського жука, і оцінити їх стійкість до деяких
збудників інфекційних хвороб, розповсюджених в Україні.

4. На основі РТ ПЛР розробити молекулярно-біологічну систему
ідентифікації вірусних РНК в рослинах цукрових буряків та виділених із
них культурах мікроміцетів.

5. Створити кДНК-бібліотеки вірусних генів на підставі длРНК і
сиквенувати фрагменти клонованих генів.

6. Визначити спорідненість клонованих фрагментів длРНК з геномними РНК
відомих фітовірусів і міковірусів з метою ідентифікації нових вірусів.

7. Отримати чисті культури штамів грибів, інфікованих міковірусами,
визначити їх систематичне положення, кількісний вміст вірусу та його
вплив на клітини грибів.

8. Оптимізувати і впровадити у виробництво біотехнологію створення
промислових плантацій хмелю на безвірусній основі.

9. Провести клітинну селекцію сортових ліній хмелю на стійкість до
стресових факторів середовища з метою створення нового сорту з високою
врожайністю, товарною якістю і стійкістю до фітопатогенів.

Об’єкти дослідження — рослини картоплі (Solanum tuberosum L.), хмелю
(Humulus lupulus L.), перцю (Capsicum annum L.), цукрових буряків (Beta
vulgaris L.), РНК вмісні фіто- і міковіруси, ізольовані молекули РНК,
ДНК копії, ізольовані гени, трансгени, інфіковані й безвірусні клітини
рослин та грибів, мікроскопічні гриби, оздоровлені та клоновані рослини.

Предмет дослідження — РНК вмісні фіто- і міковіруси, длРНК, кДНК
вірусних фрагментів геному, їх окремих генів, біологічна, біохімічна,
мікроскопічна й молекулярно-біологічна діагностика, ідентифікація,
класифікація, створення біотехнології оздоровлення, клонування та
клітинної селекції безвірусних рослин на прикладі хмелю в промислових
масштабах.

Методи дослідження — вірусологічні, біотехнологічні,
молекулярно-біологічні, біохімічні, фізико-хімічні, серологічні,
зокрема, імуноферментний аналіз (ІФА), хроматографія в градієнті
целюлози, електрофорез в агарозному і поліакриламідному гелях (ПААГ),
трансмісійна й сканувальна електронна мікроскопія, реверс транскрипція,
полімеразно-ланцюгова реакція (ПЛР), клонування, сиквенування кДНК
вірусних длРНК, культивування та розмноження рослин in vitro тощо.

Наукова новизна одержаних результатів. Шляхом аналізу клонованих
фрагментів длРНК, виділених із рослин цукрових буряків, ідентифіковано,
визначено морфологічні та біологічні властивості нового міковірусу
Helicobasidium purpureum Рartitivirus. Встановлено і зареєстровано в
світових генетичних банках даних нуклеотидну та амінокислотну
послідовності фрагмента гена РНК-залежної РНК-полімерази.

Виявлено високий рівень ураження деяких чистих культур мікроміцетів
міковірусом Helicobasidium purpureum Partitivirus. Концентрація вірусу в
культурі Shizophillum sp., визначена методом ПЛР у реальному часі,
становить 7,33 Х 1010 вірусних часток на 50 мг міцелію.

Підтверджено можливість змішаних фіто- і міковірусних інфекцій в
рослинах цукрових буряків, що виявляється як спорідненість длРНК,
виділених із рослин, з геномними РНК фітовірусів та міковірусів.

Вперше показано, що репліказа криптичного вірусу цукрових буряків (Beet
cryptic virus 3) не входить в єдиний кластер ферментів репліказ
міковірусів родини Partitiviridae. Ці дані підтверджують тезу щодо
сумнівності існування криптичних партітівірусів цукрових буряків.

Вперше визначено видовий склад мікроміцетів у листках, коренеплодах та
ризосфері цукрових буряків і отримано чисті культури грибів, уражених
міковірусом Helicobasidium purpureum Partitivirus.

Методом молекулярної ідентифікації видів за нуклеотидними
послідовностями внутрішніх трансляційних спейсерів рибосомальних генів
визначено належність вірусінфікованих культур базидіальних грибів до
родів Peniofora, Thanatephorus, Schizophillum.

З’ясовано причетність міковірусів до виникнення гнилей коренеплодів
цукрових буряків, що викликаються мікроміцетами, і показано можливість
оцінки шкодочинності мікопатогенів за наявністю в рослинах вірусних
длРНК.

Практичне значення отриманих результатів. Вдосконалена методика
виділення і очистки, а також оптимізовані процедури ідентифікації
дволанцюгових геномних РНК міковірусів та реплікативних РНК фітовірусів
впроваджені в лабораторну практику. На їх підставі розроблено «Спосіб
діагностики та ідентифікації РНК-вмісних фітовірусів», запатентований в
Україні.

Розроблена молекулярно-біологічна технологія ідентифікації 35S промотора
вірусу мозаїки цвітної капусти та гена Cry IIIA в геномах трансгенних
сортів картоплі, стійких до колорадського жука, являє собою першу
вітчизняну тест-систему для виявлення генетично модифікованих рослин.

Встановлені властивості нового міковірусу, отримані кДНК-бібліотеки
вірусних генів, а також сиквенси фрагментів гена РНК-залежної
РНК-полімерази міковірусу Helicobasidium purpureum Рartitivirus й гена
цитоплазматичних включень потівірусу мозаїки буряків являють інтерес для
вивчення структурно-функціональної організації, походження і еволюції
вірусів, а також їх систематики та класифікації.

На підставі визначення видового складу мікроміцетів цукрових буряків і
виявлення впливу міковірусів на фітопатогенні властивості грибів вперше
в Україні запропоновано оцінювати шкодочинність мікопатогенів та
необхідність захисту рослин за наявністю в них вірусних длРНК.
Науково-технічну розробку «Оцінка на вірусоносійство та ступінь
ураженості цукрових буряків з метою вивчення розповсюдженості деяких
фітопатогенних вірусів та мікроскопічних грибів», впроваджено у
виробництво.

Вперше розроблена, запатентована і впроваджена в Україні біотехнологія
формування промислових плантацій хмелю на безвірусній основі дає
можливість забезпечити конкурентноспроможність хмелярства за рахунок
підвищення життєздатності, стійкості до фітопатогенів, енергії росту,
сортової однорідності та врожайності рослин, а також товарної якості
продукції.

Новий сорт хмелю «Національний», отриманий методом клітинної селекції,
зареєстровано Держсортслужбою України і рекомендовано для застосування
у пивоварінні.

Результати дисертаційної роботи використовуються у навчальному процесі в
Національному аграрному університеті України, які включені в
лабораторні і лекційні матеріали спецкурсів «Фітовірусологія»,
«Біотехнологія рослин» та «Екобіотехнологія». Указом Президента України
від 19 грудня 2005 року № 1782/2005 за підручник “Біотехнологія рослин”
дисертант удостоєний Державної премії України в галузі науки і техніки.

Особистий внесок здобувача. Дисертаційну роботу сплановано і виконано
автором з участю наукового консультанта д.б.н., професора, академіка
УААН А.Л. Бойка. Ідеї, гіпотези та теоретичні концепції роботи належать
здобувачеві. Автор дисертації є основним виконавцем досліджень. Роль
співавторів в проведенні експериментів визначена у відповідних
публікаціях та письмових угодах. Окремі результати досліджень
опубліковані у співавторстві (Смирнова С.О., Спиридонов В.Г., Мартин
Г.Г., Дьячкова О.О., Клюваденко А.А., Кожукало В.Є., Зубова Т.І.,
Олексієнко І.П., Дубін О.В., Оверченко В.В., Кляченко О.Л.), і цитуються
при обговоренні деяких висновків дисертаційної роботи. Експериментальні
дані, що увійшли в дисертаційну роботу, не дублюються, сплановані,
виконані і належать особисто дисертанту.

Значну частину досліджень виконано також на базі дослідних господарств
та лабораторій Національного аграрного університету (НДГ
“Великоснітинське” ім. О.В. Музиченка), в лабораторії вірусології
Університету штату Луїзіана, США (зав. лабораторії проф. Rodrigo A.
Valverde), Інституті молекулярної біології та генетики НАН України
(ст.н.с. Дмитренко В.В.), Інституті мікробіології і вірусології НАН
України ім. Д.К. Заболотного (д.б.н. Жданова Н.М.), Інституті ботаніки
ім. М.Г. Холодного НАН України (д.б.н. Бухало А.С.), відділі хмелю
Інституту сільського господарства Полісся УААН (к.б.н. Шабликін В.В.,
к.б.н. Михайличенко К.П., к.б.н. Заграфова М.Й.), Інституті вірусології
ім. Луї Пастера м. Страсбург, Франція (зав. лабораторії доктор Barbara
Winsor), лабораторно-тепличних господарствах МПП “Апекс”, польових
стаціонарах Науково-технологічного селекційного центру “Полісся” (Вознюк
С.І.). Автор висловлює щиру подяку за корисні поради і допомогу в
плануванні, проведенні експериментів та обговоренні результатів.

Апробація результатів дисертації. Результати досліджень, які увійшли в
дисертаційну роботу, доповідались і апробовані на семінарах кафедри
екобіотехнології та біорізноманіття НАУ, Міжнародній конференції з
проблем рослинного онтогенезу в природному та трансформованому
середовищі (Львів, 1998), Міжнародній конференції “Біологічні ресурси та
віруси” (Київ, 1998), International Hop Growers Convention (Pulawy,
Poland, 1998), 3rd International Symposium Recent Adv. In Plant
Biotechnology (Stara Lesna, High Tatras, Slovak Republic, 1999), UK –
Ukraine Workshop on Plant biotechnology (Norwich, UK, 1999), ІV –
Міжнародній виставці навчальних закладів “Сучасна освіта в Україні –
2001” (Київ, 2001), 37th Croatian symposium on agriculture with an
International Participation. (Opatija, Croatia, 2001), 2nd Global
Conference of GCHERA “Bringing the world agricultural higher education
and research community together to meet global challenges” (San
Francisco, California USA, 2001), ІІІ Міжнародній конференції
“Біологічні ресурси та віруси” (Київ, 2001), Bulgarian – Ukrainian
Seminar on Plant biotechnology (Lessidren, Bulgaria, 2001),
Международной конференции молодых учених, посвященной 185 – летию
Харьковского государстенного аграрного университета им. В.В. Докучаева.
(Харьков, 2001), International Symposium Plant under Enviromental
stress. (K.A. Timiryazev Institute of Plant Physiology. Moscow, 2001),
FAO/WHO Global Forum of Food Safety Regulators “Improving Efficiency and
Transparency in Food Safety Systems Sharing Experiences” (Marrakech,
Morocco, 2002), 2nd Ukrainian – Bulgarian Workshop on Plant
Biotechnology. (Yalta, Crimea, Ukraine, 2002), VІ Міжнародній виставці
навчальних закладів “Сучасна освіта в Україні – 2003” (Київ, 2003), 3rd
Global Conference of GCHERA “Global reforms in higher education and
research: Responding to challenges to quality and safety of food and
agricultural products” (Kyiv, 2003), Міжнародній конференції “Promoting
quality internships and work experience for Students and Professionals
Worldwide” (Costa Rica, 2003), науково-практичному семінарі “Проблеми
використання генетично-модифікованих та клонованих організмів” (Біла
Церква, 2004), ІІІ Міжнародній науково-практичній конференції “Актуальні
питання гігієни харчування та безпечності харчових продуктів: збагачення
раціону харчування: медичні проблеми, практичні рішення”. (Київ, 2004),
Міжнародній конференції “Науково-методичне забезпечення викладання
біологічних дисциплін в аграрних ВУЗах” (Київ, 2004), Міжнародній
конференції “Біоекотехнології та біопалива в агропромисловому
виробництві” (Київ, 2004), V Симпозіумі Україна-Австрія (Київ, 2004), IV
Міжнародній конференції “Біоресурси та віруси” (Київ, 2004), ІІ з’їзді
токсикологів України (Київ, 2004), VІII Міжнародній виставці навчальних
закладів “Сучасна освіта в Україні – 2005” (Київ, 2005), NATO Advanced
Reasearch Workshop “ Significance pf virus diseases for crop biosecurity
in a developing European community” (Kyiv, 2005), 4rd Global Conference
of GCHERA “Strengthening the Service Mission of Universities and
Research Institutions for Sustainable Global Development” (Hagzhou,
China, 2005), ІХ Міжнародній виставці “Екологія–2006”, Київ, 2006).

Публікації. За матеріалами дисертації опубліковано 50 наукових праць, в
тому числі, 5 підручників, навчальних посібників та лабораторних
практикумів, 30 статей у провідних фахових журналах, 1 стаття у збірці
наукових праць, 2 патенти України на винаходи, 1 методична рекомендація
та 11 тез доповідей на наукових конференціях.

Структура та обсяг дисертації. Дисертація складається із вступу, огляду
літератури, методів і об’єктів досліджень, експериментальної частини,
аналізу й узагальнення результатів, висновків, списку використаних
джерел та додатків. Робота викладена на 297 сторінках основного тексту,
містить 11 таблиць та 95 рисунків. Список використаних джерел включає
301 найменування.

ОСНОВНИЙ ЗМІСТ РОБОТИ

Матеріали і методи дослідження. Для проведення біотестування на вірусну
інфекцію проводили механічну інокуляцію чутливих рослин-індикаторів
(тютюну, кабачків, томатів, лободи, квасолі, перцю, тощо) із
використанням 0,05 М КФБ рН 7,4 в якому гомогенізували висічки із
симптоматичних листків дослідних рослин картоплі, хмелю, перцю та
цукрових буряків. Зовнішні симптоми ураження фіксували на 7 – 21 добу .

Виділення фітовірусів здійснювали за стандартними методиками
ультрацентрифугування із деякими власними модифікаціями. Віруси виділяли
з листків та пагонів рослин з вірусспецифічними симптомами із
використанням різних екстрагуючих буферних систем: 0,1М Na- фосфатний
буфер рН 7,0; 7,4; 8,0; 0,1М трис-НCl рН 7,0; 7,4; 0,3М гліциновий буфер
рН 8,5; 0,1М боратний буфер рН 7,6; 7,5. Ступінь чистоти вірусних
препаратів визначали спектрофотометрично при довжині хвилі 230-280 нм
[Adams, Barbara, 1982; Мельничук та ін. 1997].

Для серологічної діагностики вірусів застосовували ІФА DAS-ELISA з
власною модифікацією. Для цього зразки рослинних проб масою 1г
гомогенізували у 4 мл буфера для екстракції (Е), який готували з
використанням карбонату натрію 1,59 г/л і додавали бікарбонат натрію
2,93 г/л, азід натрію в кількості 0,2 г/л та полівінілпіролідон (MW
40000) 20,0 г/л. Рецептура приготування Е буфера розроблена компанією
Agdia. Концентрацію білка супернатанта вимірювали за методом Бредфорда.
Дослідні зразки використовували в кількості 20 мкг/мл у трьох
повторностях. Сенсибілізацію полістерольних планшет (Nunc “Maxisorb”)
проводили специфічними поліклональними кролячими сироватками до Х-ВК,
S-ВК, М-ВК, Y-ВК та ВТМ виробництва Чернігівського НДІ с/г мікробіології
УААН у кількості 10 мкг/мл протягом ночі при +4оС. Кон’югат протеїн
А-пероксидази хрону для виявлення комплексів антиген-антитіло
використовували у розведенні 1/1000, розчин субстрату для пероксидази
хрону та хромоген ОФД (ортофенілендіамін) фірми “Діапроф-Мед”.
Результати аналізу фіксували на імуноферментному аналізаторі STAT FAX
303 PLUS “Awareness technology” при довжині хвилі 492/630 нм. Контролями
слугували зразки, розбавлені в 1 мл дистильованої води, при цьому
ставили не менше одного негативного і позитивного в кожній плашці.

При роботі із трансгенною Bt-картоплею, трансформованої геном CryIIIA
[Perlak et al, 1993] використовували листки, стебла та бульби. Геномну
картопляну ДНК виділяли з проростків за описаною методикою [Boom et al,
1990], але з власною модифікацією із застосуванням 4% водної суспензії
сорбенту (Silica) для осаджування сорбенту.

Для виділення і очищення длРНК вірусного походження використовували
целюлозний градієнт (Whatman CF-11). Гомогенізацію рослинних зразків
масою 3,5 г проводили в буферному розчині STE (0,1M NaCl, 0,05 M
tris-HCl, 1,0 mM EDTA, pH 7,0), а виділення та очистку нуклеїнових
кислот — класичним фенольним методом. Фракцію вірусних длРНК переводили
на STE буфер без етанолу і концентрували в двох об’ємах охолодженого 95%
етилового спирту та 0,1 об’єму 0,2 М натрій ацетату, рН 5,5 [Morris,
Dodds, 1979]. Отримані зразки длРНК ресуспендували в 200 мкл STE буфера,
обробляли ферментом DNAase 1 (№ D-4638, Sigma, USA) в розведенні 10 mg:1
ml дистильованої води і здійснювали електрофорез в 1% агарозному гелі та
6% ПААГ використовуючи прилад фірми “BIORAD”. Маркерами слугували
комерційні молекули ДНК фага лямбда після обробки ферментами EcoR1 та
Hind III, маркер DNA ladder та DNA ladder plus.

Цитологічні і мікроскопічні дослідження виконані в трансмісійних та
сканувальних електронних мікроскопах ЭМВ 100А (НАУ), JEM 1200 ЕХ, JEM–
100 (Луїзіанський університет, США) при інструментальних збільшеннях 20
– 150 тисяч із використанням 2% ФВК, рН 7,0 та 2% уранілацетату (УА).
Дизайн та синтез специфічних олігонуклеотидних праймерів для ПЛР
проводили власноруч за допомогою комп’ютерної програми “Primer Express”
(Applied Biosystems) чи on-line, із використанням програми Primer 3 (
HYPERLINK «http://www.genome.wi.mit.edu/cgi-bin/primer3)/»
http://www.genome.wi.mit.edu/cgi-bin/primer3)/ і подані в табл. 1.

Таблиця 1

Використані в роботі синтезовані олігонуклеотидні праймери

Номер та назва праймеру Нуклеотидна послідовність (5ґ-3ґ)
Призначення

1. P1-6N GCCGGAGCTCTGCGAATTNNNNNN Синтез кДНК бібліотеки

2. Р1 GCCGGAGCTCTGCGAATT Ампліфікація кДНК

3. Т7Р TAATACGACTCACTATAG Відбір позитивних клонів

ПЛР

4. SP6P ATTTAGGTGACACTATAGAA

5. ВMV1 TTTCGAGGCACCTATCATCC Ідентифікація нового міковірусу

6. ВMV2 AGCAAGTTGGACGAGGTTGT

7. 35SF GCCATCATTGCGATAAAGGA Виявлення 35S промотору ВМЦК

8. 35SR GATAGTGGGATTGTGCGTCA

9. Random NNNNNN Реверс транскрипція

10. CryF1 TGGAGAAGAGTGGGGATACG

Виявлення CryIIIA

Трансгену

11. CryR1 GTGCGATAAGATCGAGCACA

12. CryF2 GCCTACAAGCTGCAATCTGG

13. CryR2 GTGAAGGTGATCTGGCTGGT

14. PVX1 ACAGGCTGCTTGGGACTTAG Виявлення ХВК

15. PVX2 TCTAGGCTGGCAAAGTCGTT

16. PVY1 CGGAGTTTGGGTTATGATGG Виявлення YВК

17. PVY2 TGGTGTGCCTCTCTGTGTTC

18. PVM1 TAACTGCAGATGCCGTCTTG Виявлення МВК

19. PVM2 TGCGATGTCTTTGTGCGTAT

20. PVS1 GGCGTCATACTGAARGTGGT Виявлення SВК

21. PVS2 ATCCGAAGGTGGCCTATTCT

22. EFP1 TTTGGCCCTACTGGTTTGAC Ампліфікація фактору

елонгації EF1б

23. EFP2 GACAGCAACAGTTTGCCTCA

24. ITS1 TCCGTAGGTGAACCTGCGG Ідентифікація грибів

25. ITS4 TCCTCCGCTTATTGATATGC

Для отримання компетентних клітин E.coli брали 50 мл розчину А та
інокулювали клітинами одиничної колонії E.coli. Культуру вирощували до
оптичної густини DO600 0,3–0,4, клітини осаджували центрифугуванням.
Після вилучення супернатанту клітинний осад суспендували в 0,5 мл
розчині А з наступним додаванням 2,5 мл розчину В. Отриману суспензію
розділяли на аліквоти по 200 мкл, зберігали при температурі –70оС.

Трансформацію E.coli плазмідною ДНК визначали за методикою [Nishimura,
Morita, 1990]. Після інкубації клітини висівали в чашки з агаризованим
LB середовищем, яке містило необхідний селективний антибіотик (ампіцилін
або канаміцин). Для виявлення нуклеотидної послідовності плазмідну ДНК
виділяли за допомогою набору Midi plasmid purification kit Genomed.

Реакції рестрикції і лігування ДНК здійснювали в реакційній суміші
об’ємом 20 мкл з додаванням 1 мкг ДНК та по одній одиниці активності
кожного з ферментів рестрикції. Суміш інкубували протягом 3 год при
37оС, після чого додавали 3 мкл буфера для електрофорезу та наносили у
лунки 1% агарозного гелю. Після завершення електрофорезу гель
забарвлювали 1% розчином бромового етидію, аналізували в умовах
ультрафіолету і фотографували за допомогою системи “BIOTEST”.

Електропорацію E. coli чужерідною ДНК проводили в кюветах 1мм (Equibio)
на електропораторі Gene Pulser (BioRad) з опором 200 Ом, ємність
конденсаторів складала 25 мкФ, напруга — 1,8 кВ, імпульс — 3,8 мс.

Клонування фрагментів ПЛР у Т-вектор виконували за методом прямого
клонування генів. Для цього РНК переводили у кДНК. Реакцію
реверстранскрипції (РТ) моделювали з 0,2 мкг дослідного зразка длРНК,
який попередньо обробляли ДНКазою RQ1 (Promega) та денатуровано
нагріванням до 1000С. Синтез першого ланцюга кДНК ініціювали за
допомогою 0,15 мкг праймера P1-6N та зворотної транскриптази AMV
(Promega). Реакцію проводили за стандартних умов: 1 год при 420С та 30
хв при 520С. Після інкубації праймер P1-6N вилучали з реакційної суміші
за допомогою ультрафільтрації через колонку Nanosep-30 (Pall filtron).
Для ампліфікації одержаної кДНК до реакційної суміші додавали 1мкМ
праймеру Р1 та ініціювали полімеразну ланцюгову реакцію (ПЛР) з
використанням Taq полімерази за наступних умов: початкова денатурація
при 950С–4 хв десять циклів: 950С–1хв., 550С–2хв., 720С–3хв., та
тридцять циклів: 940С–50с, 550С–1хв, 720С–1,5хв; заключний синтез при
720С–10хв.

Для створення кДНК бібліотеки вірусних длРНК клонували ПЛР продукти у
вектор pGEM-T із використанням “pGEM®-T Easy Vector Systems” (Promega),
трансформували бактеріальні клітини E. coli штаму XL-1 blue
(Stratagene).

Рекомбінантні бактеріальні клони відбирали за допомогою блакитно-білої
селекції після інкубації трансформованих бактеріальних клітин на
селективному середовищі з X-Gal та IPTG. Подальший етап добору проводили
за розміром фрагментів кДНК в ПЛР з використанням пари олігонуклеотидних
праймерів Т7Р/SP6P. Бактеріальні клони з фрагментом кДНК більше 500 пнз
вирощували і виділяли плазмідну ДНК за допомогою “Plasmid purification
kit” (Qiagen) та визначали нуклеотидну послідовність фрагмента кДНК за
допомогою автоматичного секвенатору ABI Prism 3130 Genetic Analyzer
(Applied Biosystems, США).

Для проведення ПЛР длРНК міковірусів зразки переводили у кДНК в реакції
реверстранскрипції. Для цього реакційну суміш, яка містила близько 1 мкг
длРНК та 0,2 мкг раптових гексануклеотидів (Random primers),
денатурували нагріванням при 950С протягом 5 хв з наступним охолодженням
у льоді, після чого додавали реакційний буфер (50мМ Трис-HCl, pH 8.3, 50
мM KCl, 4мM MgCl2, 10 мM DTT), 1 мМ dNTPs та 200 U зворотної
траскриптази (M-MuLV). Реакційну суміш інкубували годину при 370С, потім
фермент інактивували прогріванням до 650С протягом 10 хв. Ампліфікацію
специфічного фрагмента гена, що кодує консервативну послідовність
вірусної РНК-залежної РНК полімерази міковірусів, проводили у
реакційному буфері: 67мМ трис-HCl, pH 8.3, 17 мM (NH4)2SO4, 2,5 мM
MgCl2, 0,1% Tween-20, 0,3 мг/мл BSA, 8% гліцеролу, додавали 2мкл
попередньої реакції реверс траскрипції, 0,5 мкМ кожного з специфічних
олігонуклеотидних праймерів ВMV1/ВMV2, 0,2 мМ dNTPs та 0,25 U
термостабільної Taq-полімерази. Температурний режим ампліфікації:
початкова денатурація при 940С – 2 хв, 30 циклів денатурації при 940С –
30 с, відпалу праймерів при 620С – 30 с, синтезу при 720С – 30 с,
заключний синтез при 720С – 2 хв. Реакцію реверс-транскрипції та ПЛР
проводили в програмованому термоциклері GeneAmp 2400 (Applied
Biosystems, США). Після ампліфікації продукти ПЛР розділяли
електрофорезом у 1,5% агарозному гелі, фарбували бромовим етидієм та
досліджували у променях ультрафіолетового світла.

Отримання кДНК. Реакцію реверс-транскрипції проводили із 0,2 мкг
сумарної РНК. Синтез першого ланцюга кДНК ініціювали за допомогою 0,15
мкг випадкових гексануклеотидів (рандом — праймерів) та 200 U зворотної
транскриптази M-MLV.

Проведення полімеразної ланцюгової реакції. Для ампліфікації фрагментів
кДНК до реакційної суміші додавали 0,5 мкМ специфічних олігонуклеотидних
праймерів (табл. 1). Як внутрішній контроль використовували праймери до
ділянки ДНК картоплі, що кодує фактор елонгації EF1-б. Параметри
ампліфікації: денатурація ДНК (940С Х 30с), відпал праймерів (550С Х
30с), полімеризація – (720С Х 30с), кількість циклів — 35.

Для виявлення 35S промотору ВМЦК трансгенних рослин синтезовано
олігонуклеотидні праймери 35SF та 35SR. Позитивним контролем слугувала
плазмідна ДНК pBI121 (Clontech), яка містила у своєму складі копію 35S
промотору ВМЦК. Для виявлення специфічного CryIIIA трансгену
використовували дві пари праймерів в трьох комбінаціях CryF1/CryR1,
CryF2/CryR2 та CryF1/CryR2 (табл. 1). Реакційна суміш ПЛР об’ємом 25мкл
містила 5х ПЛР буфер, 3мМ МgSO4, 0,2 мM dNTPs, по 0,5 мкМ кожного
праймеру, одну одиницю Taq полімерази (Amplysens) та 15-20нг зразків
ДНК. Ампліфікацію ДНК здійснювали за модифікацією Touchdown ПЛР.

Для молекулярної ідентифікації мікроміцетів із рослин цукрових буряків
використовували метод ампліфікації з метою визначення нуклеотидної
послідовності рибосомальних генів. ПЛР проводили із використанням
праймерів ITS1/ITS4 за стандартних умов із параметрами ампліфікації: 35
циклів денатурації ДНК (940С Х 30с), відпал праймерів (550С Х 30с),
полімеризація (720С Х 30с).

Northern blot аналіз для ідентифікації специфічних фрагментів
геному фіто- та міковірусів. Гібридизаційний аналіз застосовували для
ідентифікації фрагментів длРНК після їх розділення електрофорезом в
агарозному гелі. Трансфер РНК на нейлонову мембрану (Hybond N)
здійснювали пасивно і фіксували на мембрані опроміненням УФ світлом.
Зондом для гібридизації слугував специфічний продукт
реверс-транскрипції, одержаний на матриці длРНК і очищений з агарозного
гелю за допомогою QIAquick Gel Extraction Kit (Qiagen), який мітили
радіоактивною міткою dCTP32 (50 мCi) методом розсіяної приманки.
Гібридизували протягом ночі при 420С у розчині: 5х Денхард, 5х SSC, 0,1%
SDS, 50% формамід і 100 мкг/мл денатурованої ДНК з тимуса теляти.
Радіоавтографію фільтра отримували в касеті з підсилюючим екраном
протягом 8 год при — 700С і використанням рентгенівської плівки AGFA.

Кількісний аналіз методом ПЛР у реальному часі визначали на
приладі Sequence Detection System, 7000 (Applied Biosystems, США) в
присутності інтеркалюючого барвника SYBR Green-I. В реакції
використовували праймери BMV1/2 (табл. 1). Оптимізацію реакції
ампліфікації здійснювали згідно стандартного протоколу (PE, Applied
Biosystems, User Bulletin №2 applied to SYBR Green-I core reagent
protocol). Паралельно із експериментальними зразками аналізували серії
контролів: позитивного, негативного та NTC (проба, що не містить ДНК, no
template control). Для оцінки якості та відтворюваності результатів
реакції проводили у двох повтореннях. Дані експериментів оброблено
статистично з використанням програми ABI Prism version 1.2.

Нуклеотидну послідовність зразків визначали методом капілярного
електрофорезу на приладі ABI Prism 3130 Genetic Analyzer (Applied
Biosystems, США). Для пошуку і аналізу нуклеотидних послідовностей й
виведених на їх основі амінокислотних послідовностей в базах даних
DDBJ/EMBL/GenBank використовували програми BLAST та оцінювали за
критерієм Е (E values) для кожної із пари вирівняних послідовностей.
Вирівнювання (alignment) нуклеотидних або амінокислотних послідовностей
проводили за допомогою програми CLUSTAL W. Для адекватнішої оцінки
філогенетичного аналізу здійснювали два різні і незалежні методи,
зокрема найменших квадратів та Parsimony. Обидва методи включені у пакет
програм для оцінки філогенії (PHYLIP, версія 3,5). На підставі одержаних
даних будували дендрограми, які відображали філогенетичні
взаємовідносини між обраними таксономічними одиницями.

Приготування живильних середовищ для культивування рослин в умовах in
vitro. В дослідах в основному використовували живильні середовища за
прописом Мурасіге-Скуга та Уайта [Калинин и др., 1992].

Приготування живильних середовищ для культивування мікроскопічних грибів
в умовах in vitro. Ендофітну (внутрішню) мікобіоту листків та
коренеплодів культивували на твердих живильних середовищах. В усіх
випадках для культивування грибів використовували модифіковане
середовище Чапека із стандартною мінеральною часткою, але без сахарози.
Для вилучення епіфітної (поверхневої) мікобіоти буряків застосовували
метод змиву з поверхні листків, і наступним розведенням й отриманням
суспензії та глибинним посівом у розтоплене живильне середовище. Для
дослідження видового складу ризосфери застосовували метод ґрунтових
розведень. На 3, 7 та 10 добу під мікроскопом оцінювали поверхню чашки
на виявлення колоній грибів [Мирчинк, 1988].

Ідентифікація та особливості культивування ізолятів грибів. Ряд ізолятів
ідентифіковано з використанням полімерзно-ланцюгової реакції. До моменту
ідентифікації гриби вирощували на картопляно- глюкозному агарі (КГА) у
термостаті при температурі 21 — 250С.

Стерилізацію та введення в культуру in vitro рослинних експлантів
проводили для отримання стерильного вихідного матеріалу і подальшого
його введення в культуру in vitro. Для картоплі, хмелю і цукрових
буряків режими стерилізації встановлювали експериментально, згідно
загальних правил. Для стерилізації інтактних рослин користувалися
набором стерилізуючих речовин: гіпохлоритом натрію і кальцію,
препаратами срібла, сулемою, перекисом водню, перманганатом калію. Далі
експланти переносили у стерильні автоклавовані пробірки на
безгормональні і гормональні живильні середовища й переносили у світлову
культуральну кімнату з освітленням 400 лк та температурою 25±1°С
[Бутенко, 1989].

Оздоровлення in vitro рослинних культур від бактеріозів, грибів і
вірусів проводили із застосуванням методу термотерапії в поєднанні з
культурою апікальних меристем. Для розробки модельної біотехнології
масового розмноження в промислових масштабах і гарантії отримання
вільного від вірусів рослинного матеріалу використовували передані за
актом первинні експланти оригінальних сортів хмелю Слов’янка та Заграва
Інститутом сільського господарства Полісся УААН.

Статистичну обробку результатів досліджень здійснювали комп’ютерною
програмою Microsoft, а саме Microsoft Excel з врахуванням критерію t
Ст’юдента. Основний підхід при статистичних опрацюваннях
біотехнологічних маніпуляцій грунтувався на автоматичному застосуванні
базових комп’ютерних програм, які були інстальовані виробником при
проведенні багатьох аналізів, таких як ПЛР в реальному часі тощо.

РЕЗУЛЬТАТИ ДОСЛІДЖЕНЬ ТА ОБГОВОРЕННЯ

Оптимізація і модифікація методу виділення, очистки та діагностики
дволанцюгових РНК вірусів. Використання модифікованого методу
хроматографії в градієнті целюлози і електрофорезу в 6% ПААГ дозволило
провести діагностику і ідентифікацію РНК вмісних фіто- та міковірусів
шляхом виділення геномних одноланцюгових РНК (олРНК) чи проміжної
вірусної форми длРНК на стадії її біосинтезу (реплікації). Запропонована
нами модифікація даного методу, на відміну від класичного [Morris,
Dodds, 1979], ґрунтується на проведенні чисельних досліджень і
спрямована на прискорення стадії целюлозної хроматографії нуклеїнових
кислот та фракціонування длРНК. В результаті аналізу методики нами
запропоновано проводити стадію першого низькошвидкісного центрифугування
за умов зниження обертів кутового ротору з 8000 до 6000g. Таке
центрифугування здійснюється після першого фенольного виділення
загальних нуклеїнових кислот. Водночас рекомендовано проводити тільки
одну (замість двох) стадію градієнта целюлози для длРНК з досліджуваного
зразка. В результаті першої модифікації методу в досліджуваному зразку
зберігається більша кількість загальних нуклеїнових кислот. Внаслідок їх
целюлозно-хроматографічної очистки в подальшому можливо за одну стадію
провести фракціонування вірусних длРНК, що значно скорочує час
проведення методу і заощаджує матеріальні витрати дослідника. Після
збирання фракції нуклеїнових кислот, з метою переконання в чистоті
препарату, їх обробляли ферментом – ДНКазою. Зразок для електрофорезу
отримували ресуспендуванням кінцевої фракції длРНК після целюлозного
градієнта в 200 мкл буферу STE, що вистачає для проведення п’яти циклів
електрофорезів при напрузі 100V протягом 3,5 годин. Це дозволило
детально розділити вірусні длРНК для всіх типів вірусів залежно від
морфології та заряду (рис. 1).

Особливості діагностики та ідентифікації вірусів трансгенної картоплі
(Solanum tuberosum L.). Діагностика дволанцюгових вірусних РНК,
трансгену CryIII A та 35S промотору. Листки і пагони трансгенних сортів
картоплі NL Atlantic, Superior і Russet Burbank із симптомами
скручування і хлорозу відбирали протягом вегетації до закінчення періоду
цвітіння й тестували на вірусну інфекцію та присутність трансгенів.
Показано, що при інокуляції індикаторних 16 добових рослин перцю
(Capsicum annum L.) гомогенатом симптоматичних листків картоплі на 12
добу після інокуляції проявлялись зовнішні симптоми у вигляді
скручування та слабкого пожовтіння листків.

Рис.1. Модифікація методу хроматографічної очистки длРНК

Методом електронної мікроскопії виявлено вірусні частки, які повністю
підтверджують результати аналізу на рослинах-індикаторах (рис. 2). При
серологічній діагностиці трансгенної картоплі запропоновано власну
модифікацію методу ІФА (DAS ELISA), де кон’югат специфічних антитіл з
ферментною міткою було замінено на кон’югат протеїну А з пероксидазою,
який специфічно зв’язується з Fc-фрагментами IgG. Дискретне значення
(0,05) виявляли як середньоарифметичне сумарних сигналів (рис. 3).

Доведено, що зразки картоплі сорту NL Russet Burbank були уражені
вірусами Y-ВК, S-ВК та Х-ВК. Отримані результати відображають кореляцію
з попередніми даними стосовно підвищеної чутливості картоплі до Y-ВК
[Valverde, 1990]. Cтійким до тестованих вірусів в умовах відкритого і
закритого грунту виявився сорт NL Superior із фоновим показником
чутливості (0,046) для S-ВК.

Рис. 2. Вірусні частинки Рис. 3. Ураження сортів
трансгенної картоплі

Х-вірусу картоплі (bar 100 nm) за даними
імуноферментного аналізу

Результати виділення та електрофорезу длРНК фітовірусів, що уражували
трансгенну картоплю, були дещо розбіжними по відношенню до результатів
серологічної діагностики. Експериментальні дані дали можливість
стверджувати про детекцію цим методом Х — вірусу картоплі, який
відноситься до групи Potexvirus. Він має довжину 470 – 580 нм, геном
представлений одноланцюговою лінійною РНК розміром 6,435 kb та масою 2,0
Х 106. На стадії відтворення в клітинах цей патоген утворює декілька
фрагментів специфічних длРНК, які, згідно наших та раніше отриманих
даних, описані як специфічні для Х-ВК [Valverde et al, 1990].

Важливим етапом наших досліджень було розробити молекулярно-біологічний
діагностикум на основі ПЛР по виявленню 35S промотору трансгенної
картоплі компанії Monsanto із ДНК вмісного вірусу мозаїки цвітної
капусти (ВМЦК), який виступає регуляторним елементом в більш ніж 80%
випадках для відомих генетично модифікованих рослин [Ho et al, 2000].

Для детекції 35S промотору ВМЦК використано синтезовані олігонуклеотидні
праймери № 7 та 8 (табл. 1) з утворенням продукту довжиною 163 пари
нуклеотидних залишків (пнз). Позитивним контролем слугувала плазмідна
ДНК pBI121 (Clontech), яка містить у своєму складі копію 35S промотору
ВМЦК. Для пошуку специфічного CryIIIA трансгену нами використано дві
пари праймерів (табл. 1) в трьох комбінаціях № 11 і 12 (203 пнз), № 12
йа 13 (179 пнз), а також № 10 та 12 (1086 пнз).

Для збільшення чутливості та специфічності ПЛР запропоновано модифікацію
методу — Touchdоwn [Don et al, 1991]. Суть її полягає в тому, що на
перших 10 циклів температура відпалювання праймерів знижувалась з 67 до
62оС з інтервалом у 0,5оС у кожному циклі з подальшим продовженням
реакції при температурі відпалювання 62оС.

За допомогою ПЛР показано, що сорти картоплі NL Russet Burbank та NL
Superior дійсно містять трансген CryIIIA у складі геномної ДНК порівняно
з нетрансгенними вітчизняної селекції (Слов’янка, Незабудка, Поляна)
(рис. 4).

Рис. 4. Електрофореграма продуктів ПЛР трансгенної Bt-картоплі:

NL Russet Burbank з праймерами F1/R1; 2. NL Russet Burbank з

праймерами F2/R2; 3. NL Russet Burbank з праймерами F1/R2;

4. Маркер ДНК фагу (, яка оброблена рестриктазами EcoRI таHindIII;

5. NL Superior з праймерами F1/R1; 6. NL Superior з праймерами F2/R2;

7. NL Superior з праймерами F1/R2; 8 -9. Негативні контролі —

сорт Слов’янка і Незабудка

Доведено, також, що трансген CryIIIA в цих сортах картоплі знаходиться
під контролем двох копій 35S промотору ВМЦК, які розташовані поруч, про
що свідчить наявність двох продуктів ампліфікації з використанням 35S
праймерів (рис. 5).

Рис. 5. Електрофореграма продуктів ПЛР трансгенної Bt-картоплі з

використанням 35S праймерів

1. Позитивний контроль рВІ121; 2. NL Russet Burbank;

3. NL Superior; 4 — 5 — 6. Негативні контролі -сорти
Слов’янка,

Незабудка і Поляна

На підставі цього нами пропонується схематичне зображення частини
генетичної конструкції, трансформованої в геном картоплі з наданням
стійкості проти колорадського жука (рис. 6).

Рис. 6. Схематичне зображення частини генетичної конструкції, яка

трансформована в геном картоплі NL Russet Burbank та NL
Superior з

місцями відпалювання олігонуклеотидних праймерів

Необхідно зазначити, що розроблена тест-система з 2002 р. застосовується
в практиці в наукових лабораторіях України та за кордоном [Богунов,
Гнутова, 2004] для виявлення і ідентифікації специфічного трансгену
CryIIIA у складі геномних копій в трансформованих Bt-рослинах й 35S
промотору ВМЦК в генетично-модифікованих рослинах та отриманих з них
продуктів.

Особливості виділення і ідентифікації карлавірусу хмелю (Humulus lupulus
L.) та його дволанцюгової форми РНК при реплікації. Протягом 1998 – 2005
р обстежено рослини хмелю сортів, що занесені до Реєстру сортів України
після 1995 р і вважаються новими та перспективними. Показано, що
використовуючи буферний розчин 0,1М ФБР рН 7,4 з додаванням 0,001М ДТК
та 0,01М NaCl вихід вірусу був максимальним. Для стабілізації віріонів
до буфера додавали 0,005М — 0,001М MgCl2 або CaCl2. Концентрування
вірусів оптимізували шляхом використання 4-6% ПЕГ м.м. 6000 в
присутності 0,3М NaCl, або методом диференційного центрифугування при
30000 об/хв протягом 2 годин. Виділений препарат вірусу, як правило, мав
типовий спектр поглинання нуклеопротеїна (А260/280) 1,12 — 1,25.
Електронно-мікроскопічний аналіз препаратів свідчить, що віріони мають
паличковидну морфологію із розміром в середньому 670 х 19 нм та
внутрішнім каналом 3,5-3,7 нм, які віднесено до групи Carlavirus (рис.
7).

Рис. 7. Вірусні частинки карлавірусу хмелю при

електронно-мікроскопічному дослідженні

(bar 100nm)

Для виділення і ідентифікації реплікативних длРНК карлавірусу хмелю нами
запропоновано проведення аналізу з інфікованих експериментально
інфекційним хмельовим соком індикаторних рослин квасолі та кабачків.
Виділені два фрагмента длРНК із м.м. 5,5 х 106 і 5,2 х 106 являються
характерними для карлавірусів, згідно наших та раніше отриманих даних,
для шести досліджуваних вірусів цієї групи [Valverde, 1986] (рис. 8).

Рис. 8. Дволанцюгові РНК карлавірусу рослин

хмелю з рослин — індикаторів

1 — маркер молекулярних мас GeneRuleTM

100bp DNA Ladder Plus;

2 – дл РНК вірусу огіркової мозаїки;

3 – дл РНК клостеровірусу батату;

4 – длРНК карлавірусу хмелю (50 мкл);

5 — длРНК карлавірусу хмелю (30 мкл)

Виділення та ідентифікація реплікативних форм дволанцюгових РНК вірусу
тютюнової мозаїки з рослин перцю (Capsicum anuum L.). Із мезофільних
тканин перцю (Capsicum annum L.) виявлено вірусні частинки ВТМ розміром
300 Х 18 нм (рис. 9). Виділення і очищення вірусних длРНК ВТМ на стадії
біосинтезу із рослин перцю показало розділення фракції длРНК на багато
фрагментів і повністю підтверджує раніше отримані дані з виділення та
ідентифікації длРНК ВТМ з інших рослин [Valverde, 1896] (рис. 10).

1 2 3

Рис. 9. Електроннограма ВТМ із мезофілу Рис. 10. Виділені, очищені
та розділені

листків рослин перцю ( bar 100nm) в 6% ПААГ длРНК з
рослин перцю:

трек 1 – длРНК ВТМ, трек 2 –клостеро-

вірус з рослин перцю Bell pepper,

трек 3 – маркер DNA ladder

Особливості виділення та ідентифікації РНК-вмісних вірусів цукрових
буряків (Beta vulgaris L.) на стадії реплікації. Із рослин цукрових
буряків основну увагу при виділенні длРНК привернули три зразки серед
яких були вихідні та гібридна форми БЦ-90 із Сквирського р-ну Київської
області. За результатами досліджень із таких рослин виділено три пари
длРНК вірусів з високим електрофоретичним розподілом (рис. 11)

Рис. 11. Електрофорез в 6% ПААГ виділених длРНК

(позначені стрілками) з листків рослин

цукрових буряків

1 – гібридна форма БЦ-90;

2 – батьківська чоловіча форма БЦ;

3 – батьківська жіноча форма KW- Рось;

4 – маркер фаг лямбда, оброблена EcoR1 +Hind3

За попередніми оцінками, одну пару ізольованих длРНК віднесено до
представників фітовірусів родини Partitiviridae, що вміщують
дволанцюгову геномну РНК. Загальний розмір геному таких вірусів
становить 3,34 kb і представлений двома фрагментами 1,74 kb й 1,6 kb, що
співпадає із отриманими нами даними (рис. 14, трек 1, 3). Таку пару
длРНК попередньо ідентифіковано як представника Beet 3 Alphacryptovirus
[Jordan, 1983]. Дві інші пари длРНК із розмірами 4,2 і 4,6 kb й 1,9 та
2,18 kb відповідно нами ідентифіковано як вірусні, причому останнє
твердження пов’язували із значним проявом зовнішніх симптомів на листках
рослин, що зовсім не характерно для представників криптовірусів цукрових
буряків [Brunt, 1997].

Повторення трьох пар длРНК вірусів у зразках (рис.14, трек 1) свідчить
про їх залежність у інфекційному процесі культури цукрових буряків.
Тепличні досліди з використанням відібраних інфікованих рослин
(коренеплодів) з агроценозів засвідчили підвищену чутливість уражених
вірусами буряків до мікопатогенів, зокрема гриба Botrytis cinea Fr., що
викликає сіру гниль коренеплодів. У природі, і нашому випадку, він
індукував появу побуріння та загнивання уражених коренеплодів, які з
часом вкривались сірим пухким нальотом – конідіальним спороношенням
гриба як це описано раніше [Пересыпкин, 1991]. Водночас залежно до
кількості фрагментів длРНК коренеплодів простежувалась посилена
деградація (гниття) буряків. Саме у тих рослин, що містили по три пари
длРНК (рис. 11, зразок № 1), вихід рослин після періоду зберігання у
сховищі складав біля однієї половини. Таким чином, в результаті
виділення длРНК фітовірусів і діагностики зразків цукрових буряків було
акцентовано увагу на те, що функціонування латентних вірусів цукрових
буряків до кінця не досліджено.

Для подальшої роботи з перегляду наявності криптовірусів цукрових
буряків нами поставлено завдання вивчити молекулярно-біологічні
властивості і ідентифікувати геномні дволанцюгові РНК цукрових буряків
та показати систематичну належність цих длРНК тощо.

Біотехнологічні прийоми з клонування та сиквенування фрагментів
дволанцюгових РНК цукрових буряків. Для аналізів длРНК ізольованих із
3,5г листового матеріалу цукрових буряків згідно стандартної методики з
власними модифікаціями [Bar-Joseph et al, 1983; Мельничук, Валверді,
2001; Мельничук, 2004] на останньому етапі фракцію длРНК розчиняли у
200мкл DEPC-H2O, визначали концентрацію та розділяли електрофорезом в 1%
агарозному гелі (рис. 12).

Рис.12. Електрофореграма фрагментів длРНК, які виділені

з цукрових буряків (1), та кДНК, одержаної в

реакції зворотної транскрипції (2), і розділені в 1%

агарозному гелі (фото інвертоване)

Результати електрофоретичного аналізу зафіксували наявність трьох
дискретних фрагментів длРНК, розміри яких становили близько 1,4, 1,8 і
4,0 kb (рис. 12, трек 1); фрагменти розміром біля 1,4 та 1,8 kb,
складали мажорну фракцію длРНК, фрагмент розміром 4,0 kb, ледве
фіксувався.

Із-за відсутності безпосередньої інформації щодо існування типу
збудника, яку можна отримати тільки після визначення нуклеотидної
послідовності, для ідентифікації патогенів нами клоновано кДНК, одержану
в реакції реверс-транскрипції (РТ) із використанням длРНК, виділених з
листків цукрових буряків. Комп’ютерний аналіз нуклеотидних
послідовностей виявив спорідненість фрагментів длРНК до вірусів родини
Potyviridae та Partitiviridae.

Принципова схема клонування кДНК, синтезованої на матриці виділених
вірусних длРНК, представлена на рис. 13. Нами одержано достатньо високий
спектр фрагментів кДНК від 100 до 1000 пнз. (рис. 12, трек 2). Подальша
ампліфікація кДНК із використанням специфічного праймеру Р1,
комплементарні ділянки до якого представлені у всіх фрагментів кДНК та
клонування у відповідний бактеріальний вектор, дозволили ізолювати кожну
молекулу кДНК від пулу фрагментів, присутніх у реакційній суміші.

Рис. 13. Принципова схема стратегії клонування длРНК

Після трансформації бактерій E. coli кДНК бібліотекою вірусних генів
відібрано 85 білих клонів. Подальший етап відбору проводили за розміром
фрагментів кДНК в ПЛР з використанням пари олігонуклеотидних праймерів №
3 та 4 (табл.1). На заключному етапі відібрано шість позитивних клонів,
які ми назвали pBV1/1, pBV2/1, pBV7/1, pBV8/1, pBV12/1, pBV14/1. Наявні
в базах даних білкові послідовності, що мали критерій Е менше ніж
1х10-2, оцінювали як гомологічні (табл. 2). Одержані результати
свідчать, що клони pBV7/1 і pBV14/1 належать до потівірусу мозаїки
буряків (ВМБ) й кодують часткову амінокислотну послідовність протеїнів
СІ, 6К2 та NІa-Vpg специфічного вірусу. Клони pBV1/1, pBV2/1, pBV8/1 і
pBV12/1 відзначались високими рівнями гомології і кодували часткові
фрагменти РНК-залежної РНК полімерази (РзРп) міковірусів, що належать до
родини Partitiviridae. Звідси, на нашу думку, крім вірусної інфекції
ВМБ, рослини цукрових буряків також були уражені грибами, які були
інфікованими міковірусами.

Таблиця 2

Ідентифікація виділених вірусних дволанцюгових РНК з листків цукрових
буряків

Назва клону Гомологічна білкова послідовність з бази даних Genbank #
Ідентичність, (%) E values

pBV1/1 RdRp*, Helicobasidium mompa dsRNA mycovirus, aa 66 to159 BAC23065
26 3х10-4

РBV2/1 RdRp, Heterobasidion annosum partitivirus, aa 124 to 193 ААК52739
54 2х10-21

RdRp, Helicobasidium mompa dsRNA mycovirus, aa 338 to 397 BAC23065 56
3х10-14

RdRp, Oyster mushroom isometric virus II, aa 379 to 440 ААР74192 48
2х10-11

RdRp, Ceratocystis polonica partitivirus, aa 421 to 467 ААР79988 48
6х10-6

рBV7/1 CI protein, Beet mosaic virus, aa 137

to 220 NP_954623 97 2х10-43

pBV8/1 RdRp, Heterobasidion annosum partitivirus, aa 198 to 276 ААК52739
53 5х10-18

RdRp, Oyster mushroom isometric virus II, aa 447 to 523 ААР74192 43
7х10-7

RdRp, Helicobasidium mompa dsRNA mycovirus, aa 338 to 397 BAC23065 36
6х10-6

pBV12/1 RdRp, Heterobasidion annosum partitivirus, aa 126 to 238
ААК52739 53 3х10-35

RdRp, Helicobasidium mompa dsRNA mycovirus, aa 338 to 442 BAC23065 48
6х10-22

RdRp, Oyster mushroom isometric virus II, aa 379 to 457 ААР74192 50
2х10-16

RdRp, Ceratocystis polonica partitivirus, aa 421 to 486 ААР79988 43
1х10-8

pBV14/1 Polyprotein Beet mosaic virus, aa 1781

to 1875 NP_954611 78 2х10-36

* – РНК-залежна РНК полімераза

При виділенні вірус-специфічних длРНК з рослинних екстрактів нами
паралельно виділено і длРНК міковірусів з грибів, якими одночасно були
уражені рослини цукрових буряків. Окрім длРНК, які представляли
реплікативну форму потівірусу мозаїки, водночас зафіксовано длРНК
неописаного раніше міковірусу, геном якого представлений двома
фрагментами длРНК, розміром 1,8 та 1,9 kbp.

Порівняльний генетичний аналіз і ідентифікація відомих та раніше
не описаних вірусів цукрових буряків. Аналіз амінокислотних
послідовностей, які кодують клоновані нами кДНК клони, виявив високий
ступінь гомології (близько 50%) у клонів pBV1, 2, 8, 12 із частковими
послідовностями РзРп міковірусів, що уражують фітопатогенні базідіальні
гриби Heterobasidion annosum та Helicobasidium mompa. Встановлено, що ці
віруси, згідно існуючої класифікації, належать до родини Рartitiviridae,
а також до інших длРНК міковірусів цієї родини (табл. 3).

Таблиця 3

Результат комп’ютерного BLAST аналізу pBV клонів на гомологію

Назва вірусу Гомологія,

% GenBank

номер E values

Heterobasidion

аnnosum Partitivirus 54 ААК52739 4х10-47

Helicobasidium mompa

V

\

^

? ? ? ?

¬

4

6

8

:

< >

@

B

X

X

\

^

?

? ?

E

?

?

R T(VBXAEY°[iiiiiaaa*aaaaaaaiiaaa*aaa

AE

o

4

@

E

o

o

????????????????¤?????????????AE

»

»

9irus 43 ВАС23065 9х10-25

Oyster mushroom

isometric virus II 44 ААР74192 9х10-24

Ceratocystis polonica

Partitivirus 35 ААР79988 1х10-9

Atkinsonella hypoxylon

Рartitivirus 31 NP604475 3х10-9

Gremmeniella abietina

RNA virus MS1 33 NP659027 2х10-7

Rhizoctonia solani virus 29 NP620659 2х10-7

Penicillium

stoloniferum virus S 35 ААN86834 2х10-6

Discula destructiva

virus 1 34 NP116716 3х10-6

Zygosaccharomyces

bailii virus Z 27 NP624325 1х10-5

Mycovirus Fuso V 34 NP624350 2х10-5

Fusarium poae virus 1 25 NP624349 0,13

Комп’ютерний аналіз деяких часткових амінокислотних послідовностей, що
кодуються длРНК елементами виділеними з листків цукрових буряків,
підтвердив високий ступінь гомології до РзРп міковірусів, які належать
до родини Рartitiviridae. З метою встановлення родинних стосунків між
послідовностями РзРп, що кодуються длРНК елементами з цукрових буряків
та РзРп міковірусів, які належать до родини Рartitiviridae, проведено
філогенетичний аналіз згідно бази даних DDBJ/EMBL/GenBank за допомогою
програми BLAST. Із використанням двох різних і незалежних методів
найменших квадратів та parsimony із пакету програм PHYLIP (версія 3.5)
для оцінки філогенії нами побудовано дендрограми філогенетичних
взаємовідносин між обраними таксономічними одиницями. З’ясовано, що
амінокислотні послідовності клонів pBV 2,8,12 частково перекриваються та
гомологічні висококонсервативній карбоксі-термінальній ділянці РзРп,
водночас, як клон pBV1 був гомологічний аміно-термінальній частині РзРп
(рис.14).

Рис. 14. Схема розташування клонів pBV1,2,8,12, відносно послідовності

РЗРП міковірусу Helicobasidium mompa. Шкала демонструє

послідовність ферменту розміром у 598 а.з. Чорним ромбом

позначена консервативна послідовність GDD

На підставі амінокислотних послідовностей трьох клонів pBV 2, 8 і 12
нами виведено єдину консервативну послідовність, довжиною у 139 а.з.
(pBV2.8.12). Передбачувану амінокислотну послідовність pBV2.8.12
використовували в подальшому філогенетичному аналізі та для побудови
дендрограм. Вирівнювання часткової амінокислотної послідовності
передбачуваного клону pBV2.8.12 із послідовностями РзРп 12 міковірусів
показало, що останній містить V та VI консервативні мотиви, згідно
класифікації [J. Bruenn, 1991], які характерні для вірусних полімераз
(рис. 15).

Рис. 15. Вирівнювання часткової послідовності передбачуваного клону
pBV2.8.12

із амінокислотними послідовностями РЗРП 12 міковірусів
(скорочення

G.аbi.V. –Gremmeniella abietina вірус; M.fus.V. –
Mycovirus FusoV вірус;

P. stol.V – Penicillium stoloniferum вірус; D.destr.V. –
Discula destructiva

вірус; C.pol.V – Ceratocystis polonica вірус; A.hyp.V. –
Atkinsonella hypoxylon

вірус; Rh.sol.V. – Rhizoctonia solani вірус; F.poae V. –
Fusarium poae вірус;

H.ann.V. – Heterobasidion annosum вірус; H.mom.V. –
Helicobasidium mompa

вірус, O.mush.V. – Oyster mushroom вірус; Z.bail.V. –
Zygosaccharomyces

bailii вірус; BCV3 – криптичний вірус цукрових буряків)

Кластерний аналіз дендрограми, побудованої за методом найменших
квадратів, показав, що в родині Рartitiviridae можна виділити три групи.
Перша із них об’єднує віруси грибів Heterobasidion annosum,
Helicobasidium mompa, Oyster mushroom та клон pBV2.8.12, друга — віруси
Gremmeniella abietina, Mycovirus Fuso V, Discula destructiva і
Penicillium stoloniferum; третя — віруси Fusarium poae, Rhizoctonia
solani, Ceratocystis polonica та Atkinsonella hypoxylon (рис. 16, А).
Подібні кластери нами зафіксовано при аналізі дендрограми, побудованої
методом parsimony (рис. 16, В). Часткова послідовність pBV2.8.12 увійшла
у один кластер із першою групою вірусів родини Рartitiviridae, що
свідчить про належність передбачуваної послідовності pBV2.8.12 до
фрагментів длРНК із цієї групи міковірусів. При цьому міковірус
Zygosaccharomyces bailii, який належить до родини Totiviridae, не
ввійшов у кластер із вірусами з родини Рartitiviridae, що підтверджує
його інше систематичне положення. Доведено, що систематичне положення
криптичного вірусу цукрових буряків (Beet cryptic virus 3) згідно
амінокислотної послідовності передбачуваної репліками яка депонована у
GenBank під номером AAB27624 [Xie et al, 1993], можна ставити під
сумнів.

Рис. 16. Філогенетичні дендрограми для клону pBV 2.8.12 побудовані за
методами

найменших квадратів (А) і parsimony (В) (скорочення вірусів
аналогічні рис. 15)

Кластерний аналіз показав, що репліказа криптовірусу цукрових буряків не
входить у єдиний кластер із репліказами вірусів, що належать до родини
Рartitiviridae, а займає віддаленіше положення. На підставі одержаних
даних, нами висунуто тезу щодо доповнення теорії існування криптичних
вірусів і перегляду систематичного положення криптовірусу цукрових
буряків, якщо він взагалі існує в природі. Таким чином, встановлено, що
частина ізольованих та клонованих длРНК елементів, виділених із листків
цукрових буряків, належать до неописаного раніше міковірусу із родини
Рartitiviridae.

Ідентифікація змішаних фіто- та міковірозів на рослинах цукрових
буряків. Перевірка продуктивних сортів цукрових буряків в Україні на
присутність міковірусів методами реверс-транскрипції сполученої з ПЛР
(РТ-ПЛР) та Нозерн-блот гібридизації проведена в господарствах Київської
(зразки 1-6), Полтавської (зразки 7-12) та Вінницької (зразки 13-18)
областей з травня по жовтень 2000 – 2004 рр. Водночас нами було
проаналізовано окремо листковий матеріал (зразки 19, 20) та кореневу
систему із землею (зразки 21, 22) рослин цукрових буряків із Полтавської
області. Негативним контролем слугували листки оздоровлених рослин
буряків, введених у культуру in vitro (зразок 23). Дизайн праймерів для
розробки РТ ПЛР тест-системи на виявлення нового міковірусу грунтувався
на основі виведеної нуклеотидної послідовності клону, який кодує
висококонсервативну ділянку РзРп (рис. 17).

Рис. 17. Нуклеотидна послідовність виведеного клону pBV2.8.12, що кодує

консервативну амінокислотну послідовність РзРп нового
міковірусу.

Виділені місця відпалу праймерів для РТ-ПЛР

Розмір ПЛР продукту, передбаченого тест-системою, становив 259 п.н.з.
Нами проведено скринінг зразків цукрових буряків та показано наявність
продукту ампліфікації, відповідного розміру, що свідчить про присутність
у відповідних пробах длРНК елементів, які належать до нового міковірусу
(рис.18, 19). При цьому визначено, що найураженішими виявилися зразки
цукрових буряків, які відібрані в Полтавській та Вінницькій областях
України.

Рис. 18. Електрофореграма продуктів РТ-ПЛР, що розділені електрофорезом
у

1,5% агарозному гелі. 1-6 – зразки з Київської області;
7-12 –

Полтавської області; М – маркер GeneRuler 100bp
(Fermentas)

Рис. 19. Електрофореграма продуктів РТ-ПЛР, що розділені електрофорезом
у

1,5% агарозному гелі. 13-18 – зразки з Вінницької області;
19-20 –

Полтавської області (листки); 21-22 — Полтавської області
(корені);

21 – зразок, вирощений в умовах in vitro; 24 – негативний
контроль

РТ-ПЛР; М – маркер GeneRuler 100bp (Fermentas)

З метою доведення належності длРНК елементів з цукрових буряків,
виділених з різних регіонів України до єдиного вірусного агенту, і
встановлення розміру длРНК фрагмента, що кодує РзРп міковірусного
походження, нами здійснено гібридизаційний аналіз. Гібридизацію зразків
длРНК проводили із міченим радіоактивною міткою продуктом РТ-ПЛР, що
представляв собою фрагмент РзРп нового міковірусу. Згідно даних
гібридизаційного аналізу, позитивний специфічний сигнал виявлено із
фрагментами длРНК, розміром близько 1,9 т.п.н. (рис. 20). На підставі
одержаних даних можна стверджувати, що фрагмент длРНК, виділений із
цукрових буряків розміром близько 1,9 т.п.н., кодує РзРп неописаного
раніше міковірусу з родини Partitiviridaе. Звідси випливає, що фрагмент
длРНК, розміром 1,6 т.п.н. – кодує білок оболонки цього вірусу. Цей факт
підтверджено також і тим, що обидва фрагменти длРНК (1,6 та 1,9 т.п.н.)
виділяються виключно спільно.

Рис. 20. Гібридизаційний аналіз (Нозерн-блот) длРНК з цукрових буряків.
А –

електрофореграма фрагментів длРНК з розділенням у 1,5%
агарозному

гелі. В – радіоавтографія фільтру після гібридизаційного
аналізу. 1-6 –

зразки з Київської області; 7-10 – Вінницької області;
11-13 –

Полтавської області; М – маркер Invitrogen 1 kb

Зафіксовано, що виділений і ідентифікований нами фрагмент длРНК,
розміром 1,9 т.п.н., має філогенетичну спорідненість (гомологія 40-50%)
із генами РзРп, які кодуються міковірусами, й уражують гриби з родини
базідіоміцетів, таких як Heterobasidion annosum або Helicobasidium
mompa. Ці гриби викликають кореневу гниль хвойних (Heterobasidion
annosum) або фруктових дерев (Helicobasidium mompa). Серед мікологічних
захворювань цукрових буряків, що спричиняють кореневу гниль, описано
відомі захворювання бурої та червоної гнилі коренеплодів. Буру гниль
індукує гриб Rhizoctonia solani Kuehn, червону – Rhizoctonia violacea
(crocorum) Tul., відома також телеоморфа гриба червоної гнилі
Helicobasidium purpureum Pat., (відділ Basidiomycota) [Пидопличко, 1978;
Пересыпкин, 1987].

Отже, що фрагменти длРНК розміром 1,6 та 1,9 т.п.н., виділені з листків
цукрових буряків, належать міковірусу з родини Partitiviridae, який
уражує не цукрові буряки, а гриб кореневої гнилі, що на них паразитує.
На користь нашого припущення свідчить факт, що обидва фрагмента (1,6 та
1,9 т.п.н.) виділяються одночасно з кореневих волосків коренеплоду
цукрових буряків, один з яких — длРНК 1,9 т.п.н., виявляв позитивний
сигнал при гібридизаційному аналізі.

Вивчення видового складу мікроміцетів уражених вірусами листків,
коренеплодів та ризосфери цукрових буряків. Надалі нашим завданням було
ідентифікувати гриб-хазяїн для нового міковірусу з робочою назвою —
Helicobasidium purpureum Рartitivirus. При дослідженні видового складу
мікроміцетів листків виділено у чисту культуру та ідентифіковано близько
30 видів грибів, що відносяться до 14 родів: Acremonium, Alternaria,
Aspergillus, Aureobasidium, Cladosporium, Fusarium, Geotrichium,
Gliocladium, Mucor, Mycelia sterilia, Penicillium, Phoma, Stemphylium,
Trichoderma, Ulocladium. Для ендофітної мікобіоти характерним було
переважання видів роду Alternaria, частота зустрічальності яких
становила 85,7%; меншою мірою зустрічалися види роду Trichoderma
(42,9%). В окремих випадках, із частотою зустрічальності 14,3%, виявлено
представники родів Ulocladium, Stemphylium, Phoma, Mycelia sterilia, які
були характерними лише для ендофітної мікобіоти та види Penіcillium,
Acremonium, Gliocladium, Cladosporium, Aureobasidium, що відмічено і в
філоплані, але в значно більшій кількості. Частка невизначених видів
становила 2%. Найбільше різноманіття грибів було зафіксовано у зразка із
Полтавської області із симптомами вірусного гофрування листків. Їх
кількість становила 7 видів на 1 см2 листка. В інших варіантах вона
коливалась від 2 до 3 видів на 1 см2 листка.

Для філоплани цукрових буряків характерними є види Cladosporium, із
частотою зустрічальності 100% (в кількості 40-78 КУО/см2). Дещо рідше
зустрічалися – види р. Trichoderma та Aureobasidium (71,4%), кількість
яких становила 8-12 КУО/см2 для Trichoderma та 24-36 КУО/см2 для
Aureobasidium. В поодиноких випадках визначено колонії представників рр.
Acremonium, Alternaria, Fusarium, Gliocladium, Mucor, Basidiomycetes.
Частота зустрічальності у них коливалась від 14,5% до 29%, а кількість
від 1 до 3 КУО/см2. Найбільше різноманіття видів виявлено у варіанті із
симптомами жовтухи в Київській області. При цьому вилучено 14 видів
грибів з 1см2, на деяких зразках їх кількість коливалася в межах 3-8
видів/см2.

Таким чином, серед збудників внутрішньої інфекції філоплани відмічено
патогенний гриб Phoma betaе – збудник фомозу або зональної плямистості.
Крім того, в значній кількості вилучено види Alternaria alternata та
Cladosporium cladosporioides. В окремих випадках серед ендофітів листків
цукрових буряків визначено Stemphylium sp. та Ulocladium sp. Поверхнева
мікобіота представлена більшою кількістю і значнішою кількістю видів,
серед яких переважали Cladosporium cladosporiodes, Cl. herbarum,
Aureobasidium pullulans та Trichoderma harzianum. Серед факультативних
паразитів поверхневої інфекції виявлено види грибів Fusarium oxysporum
та Cladosporium spp. В циклі свого розвитку гриби потрапляють
безпосередньо в грунт у вигляді спор або з рештками рослин. Отже, грунт
є одним із основних джерел інфекції філоплани і коренеплодів. Саме тому
деякі з вищенаведених грибів є спільними збудниками хвороб як листків,
так і коренів.

При дослідженні видового складу коренеплодів та ризосфери цукрових
буряків нами ідентифіковано гриби, що відносяться до 24 родів. З
поверхні коренеплодів найчастіше зустрічались види р. Fusarium, що
становили 47,28 % від загальної кількості вилучених грибів. Цей рід в
основному був представлений F. oxysporum (21,20%), F. gibbosum (9,24%),
F. solani (4,89%), F. solani var. redolens ( 3,8%) та іншими. Значна
частка припадала також на види родів Rhizopus (9,78%), Chaetomium
(7,61%) та Alternaria (7,07%). В незначній кількості відмічено
Rhizoctonia violacea (crocorum) (1,09%). Частка невизначених видів
становила 6,08%. Видовий склад ризосфери цукрових буряків суттєво
відрізнявся: види р. Fusarium, Verticillium та Trichoderma становили
всього по 8,12%, натомість домінуючу позицію займали види Penіcillium–
31,2%. Вид Rhizoctonia violacea (crocorum) становив всього 0,43%.

Отже, мікобіота філоплани, коренеплодів та ризосфери цукрового буряка
була представлена видами родів: Alternaria, Trichoderma, Cladosporium,
Acremonium, Penicillium, Fusarium, а також Mycelia sterilia. З листків
нами ізольовано декілька представників роду Basidiomysetes.

Виділення в чисту культуру різних штамів грибів, уражених вірусом та
біотехнологія їх культивування в умовах in vitro. За попередніми даними
молекулярно-біологічної ідентифікації клонованих фрагментів із цукрових
буряків (безпосередньо 1,9 п.н.з) встановлено, що такий фрагмент геному
міковірусу за ознакою ураження характерний для грибів роду
Basidiomycetes. Саме тому серед виділених грибів у чисту культуру нами
обрано п’ять мікокультур, які, згідно аналізів, віднесено до цього роду.
Культури даних грибів при вирощуванні in vitro формували потужно
розвинений і переважно білий повітряний міцелій. Штам виділених грибів
№4 мав оранжевий, а №5 – червоний колір забарвлення. Вирощування ізоляту
№3 на КГА через 21 добу показало появу примордіїв та початок ростових
процесів плодових тіл, що характерно для роду Basidiomycetes (рис. 21).

Рис. 21. Утворення примордіїв та

молодих плодових тіл ізоляту

№3 на рідкому живильному

середовищі

Біохімічна і молекулярно-біологічна ідентифікація нового міковірусу
Helicobasidium purpureum Partitivirus, виділеного з листків цукрових
буряків та міцелію мікроскопічних грибів. Для підтвердження ідентичності
длРНК фрагментів, виділених з листків цукрових буряків із длРНК
фрагментами і міцелію мікроскопічних грибів, нами проведено порівняльний
аналіз методами електрофорезу длРНК в 6% ПААГ та РТ-ПЛР.
Електрофоретичний аналіз длРНК, виділених з міцелію грибів, показав
наявність двох очікуваних фрагментів длРНК у пробах № 3 і 5 розміром
близько 1,9 та 2,0 т.п.н. (рис. 22, А). Однак концентрація длРНК з
міцелію грибів була набагато нижча, ніж у разі виділення длРНК з листків
цукрових буряків (проба № 6). Згідно з отриманими раніше даними,
фрагмент длРНК розміром 2,0 т.п.н. кодує РНК-залежну РНК полімеразу
(репліказу), який має високий ступінь гомології до ферменту, що кодують
представники міковірусів з родини Partitiviridae [Doods, 1984;
Мельничук, Валверді, 2001].

А Б

Рис. 22. Електрофореграми длРНК виділених з ізолятів грибів і розділених

у 6%-му ПААГ (А) та продуктів ПЛР аналізу, розділених у
1,5%-му

агарозному гелі (Б). Номера проб (№1-5) відповідають
номерам проб,

описаних у тексті, №6 – длРНК, виділені з листків
цукрових буряків;

№7 та 8, (Б) відповідно ПЛР-позитивний та ПЛР-негативний
контроль;

М – молекулярні маркери довжини фрагментів ДНК

На рис. 22 Б показана ідентифікація фрагментів длРНК виділених з грибів
методом електрофорезу продуктів ПЛР-аналізу. Специфічний продукт ПЛР
розміром 258 п.н. виявлено у пробах № 2, 3 і 5. Наявність ПЛР продукту у
пробах № 3 і 5 узгоджується з даними наявності фрагментів длРНК у цих
пробах. У пробі № 2 фрагменти длРНК не виявлено, однак дані ПЛР показали
присутність специфічного продукту. Це може відбуватися за умов
надвисокої чутливості методу ПЛР порівняно з методом виділення та
візуалізації длРНК у ПААГ. Одержані дані свідчать, що ізоляти грибів
(проби № 2, 3 та 5), уражені новим міковірусом, названим нами як
Helicobasidium purpureum Рartitivirus. Проби № 1 та № 4 не містили
фрагментів длРНК і були ПЛР-негативними.

Кількісний аналіз дволанцюгових РНК міковірусу Helicobasidium purpureum
Partitivirus при ураженні чистих культур грибів методом ПЛР у реальному
часі. Аналізували кДНК-копії, одержані в реакції реверс-транскрипції із
длРНК, які виділяли із міцелію чистої культури грибів, ідентифікованих
нами попередньо як Mycelia sterilia, white, проби № 1, 2 та 3.
Відмічено, що на початку ПЛР реакції (цикли 1-8) продукти ампліфікації
флуоресцентною міткою ще не виявлялися і знаходились на рівні фонового
сигналу флуоресценції. Протягом експоненціальної стадії кінетики ПЛР
спостерігали пряму залежність кількості флуоресценції від циклу ПЛР.
Починаючи з 15 циклу у деяких зразків зафіксовано вихід продукту на
початок стадії плато, що свідчить про набуття ПЛР статусу насичення.
Аналіз кривих ампліфікації виявив збільшення рівня репортерної
флуоресценції на останніх циклах ампліфікації (25-28 цикли) у деяких
пробах, які в подальшому виявилися негативними. Визначено, що продукт
реакції ампліфікації виглядає у вигляді піка і має температуру плавлення
Tm 78,8±0,4(С. Для димерів праймерів остання не перевищувала 71,8(С.
Виявлення критичного циклу (Ct), дозволило визначити початкову
концентрацію ДНК-мішені, десятинний логарифм якої (log10) прямо
пропорційний Ct. За допомогою очищеного ПЛР продукту (калібрувальний
стандарт) — специфічної ДНК-мішені розміром у 260 п.н.з. із
концентрацією 7,7(1010 копій в µл, емпірично підібрана серія стандартних
розведень, значення Ct яких підпадало у діапазон відповідних значень
досліджуваних зразків. Найдостовірніші результати одержано при
використанні серії двократних розведень ДНК-стандарту (рис. 23).

Рис. 23. Графік

ампліфікації серії

двократних розведень

кДНК стандарту

(7,7(1010 – 0,48(1010 копій)

Лінійна залежність Ct від [log10] концентрації продуктів реакції
зберігалася у діапазоні 7,7( 1010 – 0,48( 1010 копій із коефіцієнтом
регресії (R2) 0.987 (рис. 24).

Рис. 24. Калібрувальний графік залежності критичного циклу (Ct) від
логарифму початкової концентрації субстрату (log [C0]) серії двократних
розведень ДНК-стандарту (7,7(1010–0,48(1010копій)

Відносне стандартне відхилення значень Сt (standard deviation) для
кожного із зразків було нижче 1,5%. Згідно отриманих результатів (рис.
23 та 24), початкова концентрація (копійність) длРНК міковірусу в
зразках 3 і 2 складала 7,33 х 1010 (SD 0,612) та 6,7 х 109 (SD 0,096)
копій длРНК на 50 мг міцелію. Це свідчить про високий рівень ураження
мікокультур описаним вперше вірусом Helicobasidium purpureum
Partitivirus. Одночасно із цим показано високий рівень специфічності та
чутливості власно розробленої молекулярно-біолоігчної тест-системи ПЛР у
реальному часі із чітко визначеною кількістю розведення ПЛР продукту.

Молекулярна ідентифікація вірусінфікованих мікроміцетів, які паразитують
на цукрових буряках. Припущення про спільне походження і розвиток
грибних інфекцій в трьох культурах (Mycelia sterilia, white 1, 2, та 3)
з цукрових буряків в умовах in vitro підтверджено результатами
молекулярно-біологічної ідентифікації з використанням тест-ситеми
сіквенсу ITS-регіону рибосомальних генів у грибів. На рис. 25
представлена схема ампліфікації ITS-регіону рибосомальних генів грибів,
молекулярну таксономію яких нами встановлено.

Рис. 25. Місця відпалу праймерів ITS1 і ITS4, які

застосовували для ампліфікації та

визначення нуклеотидної послідовності

рибосомальних генів мікроміцетів

На рис. 26, 27 і 28 наведено нуклеотидні послідовності ділянки
ITS-регіону рибосомальних генів грибів Mycelia sterilia, white 1, 2, та
3 відповідно.

Рис. 28. Нуклеотидна послідовність ITS-регіону Mycelia sterilia, white 3

Встановлено, що Mycelia sterilia, white 1 належить до Peniophora, sp.
(Eukaryota; Fungi; Basidiomycota; Hymenomycetes; Homobasidiomycetes;
Aphyllophorales; Lachnocladiaceae; Peniophora), Mycelia sterilia, white
2 — до Thanatephorus, sp. (який є анаморфою Rhizoctonia solani),
детальніше таксономічне положення (Eukaryota; Fungi; Basidiomycota;
Hymenomycetes; Homobasidiomycetes; Ceratobasidiales; Ceratobasidiaceae;
Thanatephorus. (anamorph: Rhizoctonia solani). Mycelia sterilia, white 3
— до Schizophyllum, sp. (Eukaryota; Fungi; Basidiomycota; Hymenomycetes;
Homobasidiomycetes; Agaricales; Schizophyllaceae; Schizophyllum).
Візуальна оцінка росту колоній та застосування мікроскопічного аналізу
дозволило нам встановити схожість грибних культур і віднести їх до
відділу Basidiomycota. Для підтвердження цього проведено молекулярну
ідентифікацію з метою визначення класифікаційних й таксономічних ознак
культур, і особливо тих мікокультур, що уражені міковірусом
Helicobasidium purpureum Partitivirus з метою використання їх в
біотехнологічних маніпуляціях та при проведенні біоконтролю за розвитком
грибних інфекцій цукрових буряків.

Ультраструктура та цитопатологія Helicobasidium purpureum Partitivirus
на мікроміцетах цукрових буряків. Для вивчення мікроскопічної
організації клітин вірус інфікованої грибної культури за результатами
ПЛР аналізу відібрано клітини міцелію зразку № 3 (Schizophyllum, sp).
Встановлено, що вони циліндричної форми і оточені відносно щільною
клітинною оболонкою. Зафіксовано, що вірусні частинки правильної
сферичної форми із виразними капсомерами вірусного капсиду і класичною
для міковірусів зернистою структурою, знаходяться без особливої
просторової організації й мають доволі значну щільність та концентрацію
(рис. 29, клітина 1).

Рис. 29. Електронно —

мікроскопічний аналіз ультратонкого зрізу грибних гіф колонії № 3
(Schizophyllum, sp). Клітина 1 (ліворуч) – інфікована міковірусом.

Клітина 2 (праворуч) — безвірусна клітина гриба. ВЧ – вірусні частинки,

М – мітохондрія, КС – клітинна стінка.

(bar 100 nm)

Нами були досліджені також чисті грибні культури, які культивувались в
умовах in vitro. Аналіз вперше показав присутність вірусу в пробі № 5
(Mycelia sterilia, red), а згодом, після проведення ПЛР діагностики і в
ізолятах № 3 та 2 (рис. 30). Міковіруси, які виявлені в пробі №3
(Schizophyllum, sp) мікроскопічно на ультратонких зрізах, повністю
підтверджують результати, що отримані методами хроматографії длРНК та
ПЛР. Вірусні частинки відзначаються правильною сферичною формою
діаметром 30 — 40 нм, із капсомерами вірусного капсиду із типом симетрії
Т=3 (рис. 30).

Рис. 30. Вірусні частинки, які виявлені у препаратах колонії 5 (Mycelia
sterilia, red) (bar 50 nm)

Таким чином, одержані дані підтвердили наші попередні результати щодо
належності виділених длРНК-елементів розміром 1,8 та 2,0 т.п.н. не
криптичному вірусу цукрових буряків, а новому міковірусу мікроскопічного
гриба, якого ми назвали Helicobasidium purpureum Partitivirus. Така
назва віруса пояснюється тим, що його ідентифікували вперше
мікроскопічно із культури гриба № 5 (Mycelia sterilia, red) — червоної
гнилі – Rhizoctonia violacea (Crocorum) Tul., у якої відома також
телеоморфа гриба червоної гнилі Helicobasidium purpureum Pat., (відділ
Basidiomycota).

Оптимізація біотехнологічного процесу з введення, оздоровлення,
клонування та адаптації безвірусних рослин на прикладі хмелю in vivo в
промислових масштабах України. Протягом 1997 — 2004 рр. нами виконано
чисельні досліди з отримання in vitro клонованих і оздоровлених рослин
хмелю на безвірусній основі за допомогою методів біотехнології. Наступну
адаптацію in vivo проводили із використанням торф’яних та адаптаційних
контейнерів багаторазового використання. Це дозволило отримати понад 230
тис. оздоровленого матеріалу хмелю від вірусів, бактерій, грибів і
сформувати продуктивний маточник донорних рослин (рис. 31).

Рис. 31. Маточник оздоровленого хмелю в с. Кишин Житомирської
області

Зафіксовано факт, що динаміка росту таких рослин на 12 тижнів після
висадження на поля складала щонайменше 170 – 175 см від кореневища
рослин. Відпрацьована нами технологія клонування та польової інтродукції
ароматичних сортів хмелю на безвірусній основі повністю відповідає
можливостям господарств з її втілення до масового застосування у
хмелегосподарствах України з метою отримання продуктивних живців. Так,
оздоровлені in vitro рослини хмелю сорту Заграва перед формуванням
промислових плантацій, мають значні переваги у розвитку кореневої
системи порівняно із контрольними, які були отримані вегетативним шляхом
і культивували in vivo на маточнику протягом 120 діб (рис. 32, 33).

Рис. 32. Саджанець оздоровленого хмелю, Рис. 33. Саджанці хмелю
отримані

отриманий згідно технології in vitro прямим
вегетативним живцюванням

Зазначимо, що на плантаціях хмелю в с. Сінгури Житомирської області на
площі 7,6 га протягом 2005 р. отримано вже другий врожай обсягом понад
13 ц/га високоцінної та конкурентноспроможної продукції – хмелевої
шишки. Відмічено підвищення вмісту альфа-кислоти в шишках сорту Заграва
з 6,5 до 9,8%, а у Слов’янки з 5,6 до 7,7, врожайності на 20 – 25%, а
якості сировини у чотири рази.

Методом добору із сестринської форми сорту Слов’янка за вірусологічними
та молекулярно-біологічними показниками створено новий сорт хмелю
Національний. Клітинну селекцію сортових ліній здійснювали методом
добору клітини із високим рівнем стійкості до хімічних та фізичних
факторів при оздоровленні в умовах in vitro. Для масового розмноження
сорту із вмістом альфа – кислоти 9,5 – 11,0% застосовували
мікроклональне розмноження в умовах in vitro із подальшою адаптацією до
умов відкритого грунту. Сорт зареєстровано Державною службою з охорони
прав на сорти рослин України № 0471 від 26 грудня 2003 р.

ВИСНОВКИ

1. Вперше вдосконалено і впроваджено в лабораторну практику методику
виділення і очистки дволанцюгових вірусних РНК з рослин та грибів шляхом
хроматографії в градієнті целюлози.

2. Оптимізовано процедури отримання дволанцюгових геномних РНК
міковірусів і реплікативних РНК фітовірусів із рослин картоплі, перцю,
хмелю та цукрових буряків.

3. Вперше в Україні на прикладі трансгенних сортів картоплі, стійких до
колорадського жука, розроблено молекулярно-біологічну систему тестування
генетично-модифікованих рослин шляхом ПЛР-ідентифікації 35S промотору
вірусу мозаїки цвітної капусти та гена Cry IIIA.

4. Методом електронної мікроскопії, імуноферментного аналізу і ПЛР
встановлено, що трансгенні сорти картоплі NL Russet Burbank, Superior та
Atlantic значно уражуються X-, Y- та S- вірусами картоплі в польових
умовах. Вірусна інфекція спричиняє надзвичайно високу чутливість бульб
до кореневих гнилей та плісняви.

5. На основі РТ ПЛР розроблено молекулярно-біологічну систему
ідентифікації вірусних РНК, за якою встановлено, що клоновані фрагменти
дволанцюгових РНК, виділених із цукрових буряків, проявляють
спорідненість до деяких генів фітовірусів і міковірусів.

6. За даними електронної мікроскопії, аналізу клонованих фрагментів
длРНК та філогенетичних дерев, побудованих за вирівнюванням
амінокислотних послідовностей фрагментів гена РНК-залежної
РНК-полімерази, ідентифіковано новий міковірус Helicobasidium purpureum
Рartitivirus.

7. Вперше отримано і зареєстровано в світових генетичних банках даних
нуклеотидну та амінокислотну послідовності фрагмента гена РНК-залежної
РНК-полімерази міковірусу Helicobasidium purpureum Рartitivirus
(AY949837 та AAX53614), а також нуклеотидну послідовність фрагмента гена
цитоплазматичних включень (CI) ізоляту потівірусу мозаїки буряків,
виділеного в Україні.

8. Вперше визначено видовий склад мікроміцетів у листках, коренеплодах
та ризосфері цукрових буряків і отримано чисті культури грибів, уражених
вірусами.

9. Методом електронної мікроскопії ультратонких зрізів інфікованих
грибних культур показано цитоплазматичну локалізацію вірусу
Helicobasidium purpureum Рartitivirus і його негативний вплив на
клітинну стінку та органоїди гриба.

10. За нуклеотидними послідовностями внутрішніх трансляційних спейсерів
рибосомальних генів визначено належність вірусінфікованих культур
базидіальних грибів до родів Peniofora, Thanatephorus, Schizophillum.

11. Встановлено високий рівень ураження деяких чистих культур
мікроміцетів міковірусом Helicobasidium purpureum Рartitivirus.
Концентрація вірусу в культурі Schizophillum sp., визначена методом ПЛР
у реальному часі, становить 7, 33 х 1010 вірусних часток на 50 мг
міцелію.

12. Вперше в Україні розроблено і впроваджено біотехнологію формування
промислових плантацій хмелю на безвірусній основі, яка включає
оздоровлення, добір, клонування та розмноження садивного матеріалу in
vitro, а також адаптацію рослин до умов відкритого ґрунту.

13. Показано, що розроблена біотехнологія отримання саджанців хмелю
значно переважає традиційну технологію прямого вегетативного живцювання
за розвитком первинної кореневої системи рослин, ступенем їх стійкості
до фітопатогенів, а також врожайністю і товарною якістю хмелевої шишки.

14. Шляхом селекційного добору клітин із сестринської форми сорту
Слов’янка за критерієм високої стійкості до хімічних та фізичних
факторів при оздоровленні рослин in vitro створено і зареєстровано в
Україні новий сорт хмелю Національний.

ПЕРЕЛІК НАУКОВИХ ПРАЦЬ, ОПУБЛІКОВАНИХ ЗА ТЕМОЮ ДИСЕРТАЦІЇ

Мельничук М.Д., Новак Т.В., Левенко Б.О. Основи біотехнології рослин.
Посібник: – 2000, К.: Ей-Бі-Сі — 248с. (Здобувачем виконано біля третини
роботи із залученням отриманих власноруч наукових результатів).

Мельничук М.Д., Кожукало В.Є, Смирнова С.О., Мартин Г.Г. Лабораторний
практикум із загальної фітовірусології. – К:, НАУ, 2002 – 261с.
(Здобувач автор 2-х розділів і відповідальний за редакцію та видання).

Мельничук М.Д., Новак Т.В., Кунах В.А. Біотехнологія рослин: Підручник.
– К.:, ПоліграфКонсалтинг, 2003. — 520 с. (Дисертантом написано 7 із 19
розділів роботи).

Мельничук М.Д., Новак Т.В., Клюваденко А.А., Пінчук А.П. Практикум з
біотехнології рослин. — К.: НАУ, 2005.–114 с. (Здобувачем підготовлено
тему «Отримання безвірусних рослин in vitro» і здійснено загальну
редакцію видання).

Мельничук М.Д. Фітовірусологія. Посібник. – К.: ПоліграфКонсалтинг,
2005. – 200с.

Мельничук М.Д. Проблема карлавірусної інфекції хмелю в Україні //
Науковий вісник Національного аграрного університету. — 1998, №4. — С.
28 — 33.

Мельничук М.Д. Діагностика та ідентифікація РНК-вмісних вірусів рослин
на стадії бінарних форм РНК при реплікації в клітині // Бюл. Ін-ту

с.-г. мікробіол. — 2000, №8, — С. 13 — 15.

Мельничук М.Д. Реакция сверхчувствительности растений при инфицировании
фитовирусами // Бюл. Ін-ту с.-г. мікробіол. – 2000. — №6. — С. 25-28.

Мельничук М.Д. Біологічні основи по отриманню та використанню
трансгенних рослин стійких до вірусних патогенів // Аграрна наука та
освіта. – 2000. — №1. — С. 36 — 42.

Мельничук М.Д. Ідентифікація моно- та змішаних вірозів цукрового буряку
(Beta vulgaris L.) // Науковий вісник Національного аграрного
університету. — 2002. – №40. – С. 23 – 27.

Мельничук М.Д., Смирнова С.О., Кожукало В.Є. Діагностика та
ідентифікація вірусів хмелю (Humulus lupulus L.) новітньої української
селекції // Бюл. Ін-ту с.-г. мікробіол. – 2000. — №7. -С. 37-38.
(Здобувачем здійснено пошук, узагальнено дані, проведено первинне
виділення та обговорення результатів).

Мельничук М.Д., Клюваденко А.А. Давиденко О.А. Отримання безвірусного
посадкового матеріалу хмелю (Humulus lupulus L.) в умовах in vitro //
Науковий вісник Національного аграрного університету. — 2000. — №29. —
С. 47 — 52. (Здобувачем здійснено керівництво роботою, контролювання
фітогормонального складу середовища, оптимізовано технологію адаптації
рослин до умов in vivo, підготовлено матеріали до публікації).

Мельничук М.Д., Валверді Р.А. Діагностика та ідентифікація РНК-вмісних
фітовірусів на стадії їх біосинтезу шляхом вивчення фізико-хімічних
властивостей вірусних дволанцюгових РНК // Доп. НАН України. – 2001.- №
3. — С. 175 — 179. (Дисертантом виконано планування експерименту,
методичну роботу, проведено обговорення результатів і підготовку
публікації до друку, окрім графічних схем та відбору зразків, які
виконано із співавтором).

Мельничук М.Д., Спиридонов В.Г., Стеценко В.С. Фітовіруси на
трансгенній картоплі. Діагностика та ідентифікація на сортах стійких
щодо колорадського жука // Захист рослин. – 2001.- №8. — С 32.
(Здобувачем проведено відбір інфікованих зразків, діагностику рослин,
виділення длРНК, обговорення результатів та підготовку публікації до
друку).

Мельничук М.Д., Кожукало В.Є., Оверченко В.В., Смирнова С.О. Методичні
підходи по виділенню та очистці карлавірусу хмелю на плантаціях світової
колекції в Україні // Аграрна наука та освіта. – 2001. – 2, № 1. – С. 5
– 10. (Здобувачем проведено планування досліду, виділення вірусу,
обговорення результатів та підготовлено публікацію до друку спільно із
співавторами).

Мельничук М.Д., Спиридонов В.Г. Аналіз гена капсидного білка вірусу
мозаїки люцерни (CP AlMV), клонованого у вектор для трансформації рослин
pBI 121 // Мікробіол. журн. – 2001.- 63, №4. — С. 62 – 69. (Дисертантом
сплановано і частково проведено методичні роботи з біотехнологічних
маніпуляцій із ізольованими генами).

Мельничук М.Д., Спиридонов В.Г. Ідентифікація фітовірусів, що інфікують
трансгенну картоплю, стійку до колорадського жука // Мікробіол. журн. –
2002. – 63, №6. – С. 53 – 60. (Здобувачем проведено відбір інфікованих
зразків, виділення длРНК, опрацьовано і розроблено у співавторстві
модифікацію ІФА, впроваджено метод діагностики шляхом виділення длРНК із
інфікованих рослин картоплі, здійснено обговорення результатів та
підготовлено публікацію до друку).

Мельничук М.Д., Дубін А.В., Спиридонов В.Г., Мельничук С.Д. Детекція
та ідентифікація трансгенів у генетично-модифікованих рослинах на
прикладі Bt-картоплі // Мікробіол. журн. – 2002. – 64, №3. – С. 26 – 32.
(Здобувачем відібрано інфіковані і контрольні рослинні зразки, виділено
длРНК, розроблено у співавторстві тест-систему на виявлення трансгену
CryIIIA та 35S промотору, проведено обговорення результатів та
підготовку публікації до друку).

Мельничук М.Д., Дьячкова О.О., Смирнова С.О. Морфофізіологічні та
біохімічні зміни рослин перцю (Capsicum anuum L.) при інфікуванні
вірусом тютюнової мозаїки // Науковий вісник Національного аграрного
університету. — 2002. – №50. – С. 13 – 18. (Здобувачем проведено
планування експерименту, експериментальне вирощування інокульованих
рослин, діагностику вірусоносійства шляхом виділення длРНК ВТМ із
інфікованих рослин перцю).

Мельничук М.Д., Оверченко В.В., Бойко О.А., Бойко А.Л. Карлавіруси в
агроценозах // Захист рослин. – 2002. — №11. – С. 13. (Здобувачем
проведено відбір інфікованих зразків хмелю, виділено карлавірус хмелю та
підготовлено публікацію до друку).

Мельничук М.Д., Кожукало В.Е., Дьячкова О.А., Сытник С.К., Алексеенко
И.П., Смирнова С.А. Влияние вируса табачной мозаики на ультраструктуру
клеток мезофилла листа перца Capsicum annum L. // Мікробіол. журн. —
2002. – 64, № 6. – С. 35 – 40. (Дисертантом проведено
електронно-мікроскопічний аналіз вірусу тютюнової мозаїки із інфікованих
рослин перцю, обговорення та інтерпретацію результатів до друку).

Мельничук М.Д., Дьячкова О.О., Смирнова С.О., Олексієнко І.П. Зміни
активності пероксидази рослин перцю та тютюну інфікованих вірусом
тютюнової мозаїки // Физиология и биохимия культ. растений. – 2003. –
35, №1. – С.43 – 47. (Здобувачем заплановано експеримент, проведено
аналіз та обговорення результатів).

Мельничук М.Д., Дубин А.В., Сытник С.К. Идентификация и определение
локализации вирусной РНК в хлоропластах перца (Capsicum annum L.)
методом полимеразной цепной реакции // Мікробіол. журн. – 2003. – 65, №
3. – С. 54 – 59. (Дисертантом розроблено методику ідентифікації РНК
методом РТ ПЛР і проведено узагальнення результатів).

Мельничук М.Д., Оверченко В.В., Дубін О.В. Діагностика латентного
вірусу хмелю на сортах української селекції // Мікробіол. журн. – 2003.
– 65, № 4. – С. 43 – 50. (Здобувачем проведено виділення длРНК
карлавірусу хмелю, розроблено діагностикум на вірусоносійство шляхом
виділення длРНК із експериментально інфікованих індикаторних рослин та
обговорення результатів).

Мельничук М.Д., Клюваденко А.А., Михайличенко К.П. Технологія отримання
морфогенного калуса хмелю (Humulus lupulus L.) гірких сортів на
безвірусній основі в умовах in vitro // Аграрна наука та освіта. – 2003.
— 4, №3 – 4. – С.15– 21. (Здобувачем розроблено загальну схему
дослідження, оптимізовано склад живильних середовищ, здійснено
узагальнення результатів до друку).

Мельничук М.Д., Дубін О.В. Тестування та оптимізація умов проведення
ISSR-PCR при аналізі геному хмелю (Humulus lupulus L.). // Науковий
вісник Національного аграрного університету. — 2004. – №73. – С. 17 –
21. (Дисертантом розроблено загальну схему дослідження, оптимізовано
умови та параметри генетичного аналізу геному хмелю біотехнологічними
підходами).

Мельничук М.Д., Дубін О.В., Дьячкова О.О., Кожукало В.Є. ISSR-PCR та
RAPD в оцінці молекулярно-генетичного поліморфізму сортів хмелю
(Humulus lupulus L.) // Науковий вісник Національного аграрного
університету. — 2004. – №77. – С. 47 – 54. (Здобувачем сплановано
експеримент, проведено аналіз результатів дослідження, оптимізовано
умови та параметри електрофорезу фрагментів кДНК).

Мельничук М.Д., Спиридонов В.Г., Смирнова С.О. Ідентифікація вірусних
дволанцюгових РНК, виділених з цукрових буряків (Beta vulgaris) // Доп.
НАН України. – 2004. – №5, – С. 174-180. (Здобувачем проведено
планування експерименту, складено загальну схему дослідження,
біотехнологічними підходами розроблено стратегію подальшого вивчення
неописаного раніше вірусу).

Мельничук М.Д., Сивик А.Є. Генетичні модифікації рослин. Методи
виявлення у світовій практиці // Захист рослин. — 2004. – 6. — С. 8 –
11. (Дисертантом сплановано дослідження і подано логічний підхід з
стратегії ідентифікації ГМО в лабораторних дослідженнях).

Мельничук М.Д., Заграфова М.Й., Клюваденко А.А. та ін. Біологічні
технології та економічна ефективність створення маточників хмелю для
промислових плантацій // Аграрна наука та освіта. – 2004. – 5, № 3-4. –
С. 20-25. (Здобувачем проведено відбір інфікованих зразків хмелю,
комплекс вірусолого-біотехнологічних робіт з оздоровлення від
фітопатогенів та клонального мікророзмноження згідно власної
запатентованої технології, аналіз результатів та редагування
публікації).

Мельничук М.Д., Спиридонов В.Г. Филогенетический анализ частичной
последовательности вирусной РНК-зависимой РНК полимеразы, кодируемой
двухцепочечными РНК элементами из сахарной свеклы (Beta vulgaris) //
Доп. НАН України. 2004. – № 9. – С. 167-171. (Здобувачем вперше
проведено повний генетичний аналіз вірусного фермента, ідентифіковано
геном нового вірусу шляхом запропонованої власно модифікованої методики
виділення длРНК, підготовлено до друку публікацію).

Мельничук М.Д., Спиридонов В.Г. Молекулярная идентичность
двухцепочечных РНК-элементов вирусной природы, выделенных из сахарной
свеклы // Мікробіол. журн. – 2005. – 67, № 2.– С. 55–62. (Здобувачем
проведено моніторингові дослідження по розповсюдженню міковірусу із
цукрових буряків в різних регіонах України, виділення і ідентифікацію
фрагментів длРНК, їх клонування, селекцію клонів, сиквенування,
ідентифіковано новий міковірус та підготовлено до друку публікацію).

Мельничук М.Д., Зубова Т.Н., Смирнова С.О., Спиридонов В.Г. Видовий
склад мікроміцетів листя, коренеплодів і ризосфери цукрового буряка //
Мікробіол. журн. — 2005. – 67, №3.– С. 44-50. (Здобувачем проведено
роботи з оптимізації живильних середовищ по культивуванню мікокультур
виділених із цукрових буряків, розроблено біотехнологію культивування
інфікованих міковірусами грибів в умовах in vitro).

Мельничук М.Д., Спиридонов В.Г., Олексієнко І.П. Особливості вірусних
дволанцюгових РНК, виділених з мікроскопічних грибів, що паразитують на
цукрових буряках // Мікробіол. журн. – 2005. – 67, №4. – С. 52 – 58.
(Здобувачем проведено експеримент з виділення длРНК із мікокультур з
цукрових буряків, пророблено мікроскопічний аналіз мікокультур і
нативного міковірусу, розроблено біотехнологію культивування та
зберігання інфікованих міковірусами грибів, підготовлено публікацію до
друку).

Мельничук М.Д., Спиридонов В.Г. Біонебезпека трансгенних технологій з
використанням 35S промотору // Генетично модифіковані рослини:
перспективи та проблеми. Зб. доп. наук. конф. Інститут цукрових буряків
УААН, — 2002. — С. 83 – 88. (Дисертантом складено літературний огляд із
даної проблеми, обговорено результати з ідентифікації 35S промотору
трансгенних рослин із рослин Bt-картоплі та підготовлено публікацію до
друку).

Ібатуллін І.І., Городній М.М., Кривенок М.Я., Дубровін В.О., Ільчук
М.М., Мельничук М.Д., Мельничук С.Д., Пасічник Н.А., Строчинський А.А.,
Угнівенко А.М., Хмельницький Г.О. Наукове забезпечення сталого розвитку
сільського господарства в Поліссі України. Монографія в 2-х томах.
Кабінет Міністрів України, НАУ, К.: Вид-во ТОВ «Алефа», 2004.т.1 – С.
446 – 455. (Здобувачем підготовлено главу монографії в розрізі
біотехнології в хмелярстві, здійснено загальне редагування видання).

Ібатуллін І.І., Городній М.М., Кривенок М.Я., Дубровін В.О., Ільчук
М.М., Мельничук М.Д., Мельничук С.Д., Пасічник Н.А., Строчинський А.А.,
Угнівенко А.М., Хмельницький Г.О. Наукове забезпечення сталого розвитку
сільського господарства в лісостепу України. Монографія в 2-х томах.
Кабінет Міністрів України, НАУ – К.: Вид-во ТОВ «Алефа», 2003. т.2 – С.
645 — 650. (Здобувачем підготовлено практичні матеріали із власних
досліджень в розрізі фітовірусології та біотехнології рослин, здійснено
загальне редагування видання).

Пат. України на винахід №59131/7 А01Н4/00 // Спосіб клонального
мікророзмноження хмелю (Humulus lupulus L.) ароматичних сортів.
Мельничук М.Д. — Опубл. 15.05.2005, Бюл. № 5.

Пат. України на винахід №55096/7 С12Q1/68 // Спосіб діагностики та
ідентифікації РНК-вмісних фітовірусів. Мельничук М.Д. — Опубл.
16.08.2004, Бюл. № 8.

Мельничук М.Д., Новак Т.В., Пінчук А.П., Клюваденко А.А. Методичні
рекомендації для мікроклонального розмноження деревних та трав’янистих
рослин. – К.:НАУ, 2004. — 37с.

Kripkyy O.E., Melnychuk M.D., Kripkyy Ol.E. Developing of methods for
obtaining embriogenic callus and protoplasts from hops (Humulus lupulus
L.). II International Symposium on Plant Biotechnology. (4 – 8 October,
Kiev, Ukraine). – 1998. – P.67.

Мельничук М.Д., Мартин Г.Г., Смирнова С.О. Мікроскопічне дослідження
карлавіруса виділеного з рослин хмелю в умовах України //

Тез. доп. між нар. конф. “Біологічні ресурси та віруси” (Київ, 7 –10
вересня), Київ — 1998. — С. 92.

Melnychuk M.D., Martyn G.G., Smyrnova S.O., Kozhukalo V.E., Koshevski
I.I. In vitro obtaining and microscopy investigations virus-free hop
(Humulus lupulus L.). International Hop Growers Convention. (27 – 30
July, Pulawy, Poland).– 1999. – Р.136

Melnychuk M.D., Martyn G.G., Klyuvadenko A.A., Davidenko O.A. Obtaining
of the virus-free hops (Humulus lupulus L.) seedlings from the apical
morphogenic callus. Biologia, 54 Suppl. 7, 1999. – Р.72

Melnychuk M., Klyuvadenko A., Davydenko O., Spyrydonov V. Direct and
indirect in vitro morphogenesis of the hop (Humulus lupulus) // 37th
Croatian symposium on agriculture with an International Participation.
(Opatija, February 19 – 23). – 2001. – Р.252.

Мельничук М.Д., Давиденко О.А., Клюваденко А.А. Морфогенез та
розмноження рослин хмелю (Humulus lupulus L.) на безвірусній основі в
умовах in vitro // Тез. доп. ІІІ Міжнародної конф. “Біологічні ресурси
та віруси”. (Київ, 11 –15 вересня). – Київ:2001. — С. 85.

Melnychuk M.D. Pathological interactions of the hop (Humulus lupulus
L.) Carlavirus with cells and organoids membranes // Междунар. конф.
молодых учених, посвященной 185 – летию Харьковского государственного
аграрного университета им. В.В. Докучаева. (Харьков, 26 – 28 сентября).
– Харьков:2001. — С. 59 – 60.

Melnychuk M.D., Dyachkova O.O, Smirnova S.O. Some reciprocal
morphophisiological and biochemical reactions of plants at biological
stress under virus infection // Abstracs Internat.Symp. «Plant under
Environmental Stress» (Moscow, K.A. Timiryazev Institute of Plant
Physiology, October 23 –28, 2001). Moscow: Publishing Houses of Peoples
Friendship University of Russia. – 2001. – P.187-188.

Мельничук М.Д., Вознюк С.І., Мельничук А.В. Біологічні технології на
шляху підняття ефективності, якості та безпеки сировини хмелю в Україні
// Тез. доп. ІІІ Між нар. науково-практичної конф. “Актуальні питання
гігієни харчування та безпечності харчових продуктів: збагачення раціону
харчування: медичні проблеми, практичні рішення” (Київ, 13-14 травня

2004 р.). – Київ: 2004. – С.6.

Мельничук М.Д. Клонування рослин як спосіб підвищення
сільськогосподарського виробництва // Сільське господарство: наука і
практика: Матеріали V симпозіуму Україна-Австрія (Київ, 9-11 вересня
2004р.). – К.: ЗАТ “Ніч лава”, 2004. – С. 153-154.

АНОТАЦІЯ

Мельничук М.Д. Молекулярно-біологічне вивчення геномних і реплікативних
РНК фіто- та міковірусів як основа для створення рослинних
біотехнологій. — Рукопис.

Дисертація на здобуття наукового ступеня доктора біологічних наук за
спеціальностями 03.00.06 — вірусологія та 03.00.20 — біотехнологія.
Інститут мікробіології і вірусології ім. Д.К. Заболотного НАН України,
Київ, 2006.

Робота присвячена створенню і впровадженню в Україні системи
вірусологічних біотехнологій для ідентифікації фітовірусів і міковірусів
та оздоровлення рослин від інфекційних хвороб.

Вдосконалено методику, оптимізовано процедури і розроблено
молекулярно-біологічні тест-системи для виділення, очистки й
ідентифікації дволанцюгових вірусних РНК з рослин та грибів. За
результатами електронно-мікроскопічних досліджень, клонування фрагментів
длРНК та аналізу філогенетичних дерев, побудованих за вирівнюванням
амінокислотних послідовностей фрагментів гена РНК-залежної
РНК-полімерази, ідентифіковано новий міковірус Helicobasidium purpureum
Рartitivirus.

Вперше визначено видовий склад мікроміцетів в листках, коренеплодах та
ризосфері цукрових буряків, отримано чисті культури грибів, уражених
вірусами. За нуклеотидними послідовностями внутрішніх трансляційних
спейсерів рибосомальних генів визначено належність вірусінфікованих
культур мікроміцетів до родів Peniofora, Thanatephorus, Schizophillum.
З’ясовано причетність міковірусів до виникнення гнилей коренеплодів
цукрових буряків, що викликаються мікроміцетами, і показано можливість
оцінки шкодочинності мікопатогенів за наявністю в рослинах вірусних
длРНК.

Важливі науково-технічні розробки дисертаційної роботи, зокрема спосіб
діагностики та ідентифікації РНК-вмісних фітовірусів, клонального
мікророзмноження ароматичних сортів хмелю та новий сорт хмелю
“Національний” захищені патентами на винаходи та свідоцтвом про
авторство на сорт рослин.

Впровадження розробок у виробництво та їх висока ефективність
підтверджена 5 актами та 3 довідками.

Ключові слова: фітовіруси, міковіруси, мікроміцети, картопля, хміль,
цукрові буряки, дволанцюгові РНК, кДНК, реверс-транскрипція, сиквенс,
полімеразно-ланцюгова реакція, біотехнологія, діагностика,
ідентифікація, оздоровлення.

АННОТАЦИЯ

М.Д. Мельничук. Молекулярно-биологическое изучение геномных и
репликативных РНК фито- и миковирусов как основа для создания
растительных биотехнологий. – Рукопись.

Диссертация на соискание научной степени доктора биологических наук по
специальностям 03.00.06 — вирусология и 03.00.20 — биотехнология.

Институт микробиологии и вирусологии им. Д.К. Заболотного НАН Украины,
Киев, 2006.

Работа посвящена созданию и внедрению в Украине системы вирусологических
биотехнологий для идентификации фитовирусов и миковирусов и оздоровления
растений от инфекционных болезней.

Усовершенствовано методику, оптимизировано процедуры и разработано
молекулярно-биологические тест-системы для выделения, очистки и
идентификации двуцепочечных вирусных РНК из растений и грибов.

Разработано первую отечественную молекулярно-биологическую ПЦР
тест-систему по идентификации 35S промотора вируса мозаики цветной
капусты и гена Cry IIIA в геномах трансгенных сортов картофеля,
устойчивых к колорадскому жуку для выявления
генетически-модифицированных растений картофеля.

Показано существование смешанных фито- и миковирусных инфекций на
растениях сахарной свеклы, которые выявляются сродством двуцепочечных
РНК, выделенных с растений, с геномными РНК фитовирусов и миковирусов.
По результатам электронно-микроскопических исследований, клонирования
фрагментов длРНК и анализа филогенетических деревьев, построенных по
выравниванию аминокислотных последовательностей фрагментов гена
РНК-зависимой РНК-полимеразы, с растений сахарной свеклы
идентифицировано новый миковирус Helicobasidium purpureum Рartitivirus.

Впервые показано, что репликаза криптического вируса сахарной свеклы
(Beet cryptic virus 3) не входит в единый кластер ферментов репликаз
миковирусов семейства Partitiviridae. Эти даные подтверждают тезис о
сомнительности существования криптических партитивирусов сахарной
свеклы.

Изучены свойства нового миковируса Helicobasidium purpureum
Рartitivirus, получены кДНК-библиотеки вирусных генов, а также сиквенсы
фрагментов гена РНК-зависимой РНК-полимеразы миковируса и гена
цитоплазматических включений потивируса мозаики сахарной свеклы которые
представляют интерес для изучения структурно-функциональной организации,
происхождения и эволюции вирусов, а также их систематики и
классификации.

Впервые определен видовой состав микромицетов в листьях, корнеплодах и
ризосфере сахарной свеклы, получено чистые культуры грибов, пораженных
вирусами. Согласно анализа нуклеотидных последовательностей внутренних
трансляционных спейсеров рибосомальных генов, определена причастность
инфицированных вирусом культур микромицетов к родам Peniofora,
Thanatephorus, Schizophillum.

Выявлен высокий уровень пораження некоторых чистых культур микромицетов
миковирусом Helicobasidium purpureum Partitivirus. Наибольшая
концентрация вируса определена методом ПЦР в реальном времени в культуре
Shizophillum sp., которая составляет 7,33 Х 1010 вирусных частиц в 50 мг
мицелия.

Обнаружена причастность миковирусов к возникновению гнилей корнеплодов
сахарной свеклы, которые вызываются микромицетами, и показана
возможность оценки вредоносности микопатогенов присутствием в растениях
специфических вирусных длРНК.

Важные научно-технические достижения диссертационной работы касаются
разработки способа диагностики и идентификации РНК-содержащих
фитовирусов, клонального микроразмножения ароматических сортов хмеля в
производственных масшабах, что позволило получить более 230 тысяч
клонированных растений хмеля на безвирусной основе и создать новый сорт
хмеля “Национальный”, который рекомендуется для применения в виде гранул
и экстрактов в пивоварении. Работы защищены патентами Украины на
изобретения и свидетельством об авторстве на сорт растений.

Внедрение разработок в производство и их высокая эффективность
подтверждена 5 актами та 3 справками.

Ключевые слова: фитовирусы, миковирусы, микромицеты, картофель, хмель,
сахарная свекла, двуцепочечные РНК, кДНК, реверс-транскрипция, сиквенс,
полимеразно-цепная реакция, биотехнология, диагностика, идентификация,
оздоровление.

SUMMARY

Melnychuk M.D. Molecular-biological investigation of the genomic and
replicate RNA of phyto- and mycoviruses as basement for plant
biotechnologies. – Manuscript.

Thesis for Doctoral degree in Biology, specialities 03.00.06 – virology
& 03.00.20 – biotechnology. – Institute of Microbiology and Virology
after D.K. Zabolotny National Academy of Sciences of Ukraine, Kiev,
2006.

This thesis dedicated creation and implementation of the virological &
biotechnological system for phyto- and mycoviruses identification and in
vitro plants sanitation from infections in Ukraine.

It was improved methodology, optimisated procedures and developed
molecular biology test-systems for extraction, purification and
identification double stranded RNA from plants and fungies. Based on
electron microscopy analysis, cloning of the dsRNA fragments and
phylogenetic analysis of the gene fragments encoding RNA – dependent RNA
– polymerase was firstly described new mycovirus Helicobasidium
purpureum Partitivirus from sugar beet (Beta vulgaris L.) plants.

It was investigated micromycetes pool sampled from the sugar beet from
the leaves, roots and rhizosphere in different regions of Ukraine. Also
it was obtained pure fungi cultures infected by new mycovirus. According
to the results of nucleotide sequences internal translated spacers of
the ribosome genes it was established relationships virus infected
micromycetes to Peniofora, Thanatephorus, Schizophillum sp. It has been
observed relationships of the mycoviruses to root rot induction on the
sugar beet plants and also shown possibility mycoviruses pathogenic
effect based on presence virus dsRNA in sugar beet plants.

Important applied science aspects of the dissertation thesis based on
method of diagnostic and identification RNA-phytoviruses, sanitation, in
vitro cloning and multiply virus-free aroma varieties of hops (Humulus
lupulus L.) for creation donor hop gardens. The new aroma hops variety
named National was created for brewery needs with high crop capacity and
natural tolerance to the viruses.

Scientific results were extended and high efficiency have been proved by
5 official summaries and 3 letters.

Kew words: phytoviruses, mycoviruses, micromycetes, potato, hops, sugar
beet, double stranded RNA, cDNA, reverse transcription, sequence,
polymerase chain reaction, biotechnology, diagnostic, identification,
clean up.

PAGE 1

Добавить комментарий

Ваш e-mail не будет опубликован. Обязательные поля помечены *