Бета-дефенсин-2 в злоякісно трансформованих клітинах епітеліального походження (автореферат)

НАЦІОНАЛЬНА АКАДЕМІЯ НАУК УКРАЇНИ

ІНСТИТУТ ЕКСПЕРИМЕНТАЛЬНОЇ ПАТОЛОГІЇ, ОНКОЛОГІЇ І РАДІОБІОЛОГІЇ ім. Р.Є.
КАВЕЦЬКОГО

МАРКЄЄВА Наталія Володимирівна

УДК: 616-006.6:576.385.5:615.33:616-097

Бета-дефенсин-2 в злоякісно трансформованих клітинах епітеліального
походження

14.01.07 – онкологія

АВТОРЕФЕРАТ

дисертації на здобуття наукового ступеня

кандидата біологічних наук

Київ – 2006

Дисертацією є рукопис

Робота виконана в Інституті експериментальної патології, онкології і
радіобіології ім. Р.Є. Кавецького НАН України

Науковий керівник – доктор біологічних наук

Погрібний Петро Васильович,

Інститут експериментальної патології, онкології і радіобіології ім. Р.Є.
Кавецького НАН України, завідувач відділу біології пухлинної клітини.

Офіційні опоненти:

доктор біологічних наук

Кудрявець Юрій Йосипович,

Інститут експериментальної патології, онкології і радіобіології ім. Р.Є.
Кавецького НАН України, завідувач відділу експериментальних клітинних
систем;

кандидат біологічних наук

Кухаренко Олександр Петрович,

Національний аграрний університет ААН України, доцент кафедри
молекулярної генетики та біобезпеки.

Провідна установа

Київська медична академія післядипломної освіти ім.П.Л.Шупика МОЗ
України, кафедра онкології, м.Київ.

Захист відбудеться 19 квітня 2006 року о 13 годині 30 хвилин на
засіданні спеціалізованої вченої ради Д 26.155.01 в Інституті
експериментальної патології, онкології і радіобіології ім. Р.Є.
Кавецького НАН України за адресою: 03022, Київ, вул. Васильківська, 45.

З дисертацією можна ознайомитися у бібліотеці ІЕПОР ім. Р.Є. Кавецького
НАН України.

Автореферат розісланий “17“ березня 2006 р.

Учений секретар

спеціалізованої вченої ради

доктор медичних наук Н.В. Бородай

Загальна характеристика роботи

Aктуальність теми. Дослідження молекулярних механізмів, що регулюють
проліферацію, диференціювання та апоптоз в пухлинних клітинах, є одним з
перспективних та актуальних напрямків фундаментальної онкології. Сучасна
онкологія розглядає рак як захворювання, викликане порушеннями регуляції
процесів проліферації і контролю росту та загибелі клітин. Прогресія
пухлини супроводжується накопиченням великої кількості аномалій в
експресії біологічно активних пептидів та факторів росту, які
опосередковують складну взаємодію між нормальними і неопластичними
клітинами, що обумовлює метастатичний потенціал пухлини.

З цих позицій перспективним є дослідження відносно нового класу
пептидних антибіотиків – дефенсинів. Нещодавно було показано, що роль
дефенсинів не обмежується лише забезпеченням первинного неспецифічного
антимікробного захисту. Дефенсини можуть також впливати на різні ланки
імунної системи, підсилюючи продукцію специфічних антитіл (A. Biragyn et
al., 2001;), викликаючи хемотаксис імунокомпетентних клітин та активуючи
незрілі дендритні клітини (J.J. Oppenheim et al., 1999; A. Biragyn et
al., 2002). Крім того, дослідження останніх років показали, що дефенсини
можуть впливати на ріст, проліферацію та диференціювання епітеліальних
клітин (J. Aarbiou et al., 2002; J. Aarbiou et al., 2004), а в окремих
випадках експресія їх генів корелює із злоякісною трансформацією та
рівнем диференціювання клітин (A. Liu et al., 2002; M. Nishimura et al.,
2004). В останні роки було продемонстровано, що пухлинам епітелія
ротової порожнини (J.E. Meyer et al., 2004), вульви і шийки матки (P.V.
Pogrebniy et al., 2001; P.V. Pogrebniy et al., 2004), товстої кишки та
шлунка (J. Albrethsen et al., 2004; N.Uehara et al., 2003) людини
властива підвищена експресія дефенсинів.

В 2004-2005 роках опубліковані результати перших досліджень щодо
виявлення рівня дефенсинів в крові онкологічних хворих. Було
встановлено, що рівень пептиду HBD-1 в сироватці крові хворих на рак
легені можна розглядати як допоміжний діагностичний маркер цього
захворювання (Y. Arimura et al., 2004), а альфа-дефенсинів 1-3 або
альфа-дефенсину-6 в комбінації з іншими діагностичними маркерами – як
маркери раку товстої кишки (J. Albrethsen et al., 2004; C. Melle et al.,
2005; M.J. Nam et al., 2005). Дослідження, проведені в нашому відділі
показали, що в деяких лініях злоякісно трансформованих клітин експресія
гена бета-дефенсина-2 (hBD-2) індукується внаслідок дії факторів росту
(ЕФР, ТФР-(). Експресія гена hBD-2 була також виявлена в зразках пухлин
шийки матки та вульви(Lisovskiy I.L. et al., 2001). В той же час
біологічна роль дефенсинів при злоякісній трансформації ще мало вивчена,
тому дослідження впливу дефенсинів на малігнізовані клітини, особливості
їх експресії та продукції пухлинними клітинами є актуальним питанням
сучасної онкології.

Зв’язок роботи з науковими програмами, планами, темами. Робота виконана
в рамках програм ДКНТ України та Міністерства України у справах науки і
технологій (шифр 2/1297-97, № 0198U005252; шифр 02.04/04439, №
0198U005179), цільової наукової програми НАН України “Молекулярні основи
функціонування геному” (шифр 2.2.5.231, № 0102U003228) та плану
науково-дослідних робіт Інституту експериментальної патології, онкології
і радіобіології ім.Р.Є. Кавецького НАН України (шифр 2.2.5.209, №
0198U001092).

Мета роботи. Дослідити вплив рекомбінантного бета-дефенсина-2 людини на
життєздатність і проліферацію злоякісно трансформованих клітин in vitro
та з`ясувати особливості експресії гена hBD-2 та продукції
бета-дефенсина-2 в епітеліальних пухлинах шлунка та шийки матки людини.

Задачі дослідження:

Розробити схему отримання і очистки активного рекомбінантного
бета-дефенсина-2 людини.

Отримати та охарактеризувати моноклональні антитіла до бета-дефенсина-2
людини.

Визначити вплив рекомбінантного бета-дефенсина-2 на життєздатність та
проліферацію клітин епітеліального походження ліній А-431, M-HeLa, KB та
МСF-7.

Дослідити вплив екзогенного бета-дефенсина-2 в клітинах ліній А-431 та
M-HeLa на ЕФР-рецепторний каскад передачі мітогенного сигнала.

Визначити рівень експресії гена бета-дефенсина-2 в зразках пухлин та
гістологічно незміненої слизової оболонки шлунка людини.

Дослідити особливості продукції бета-дефенсина-2 в тканинах пухлин
шлунка та шийки матки людини.

Об’єкт дослідження – проліферативна активність епітеліальних злоякісно
трансформованих клітин людини за умов стимуляції рекомбінантним
бета-дефенсином-2.

Предмет дослідження – експресія hBD-2 на рівні мРНК та білка в зразках
пухлинних та гістологічно незмінених тканин шлунка та шийки матки
людини.

Методи дослідження – біохімічні (електрофорез білків в поліакриламідному
гелі, афінна хроматографія та гель-фільтрація); мікробіологічні
(трансформація та культивування бактерій); методи молекулярної біології
(ЗТ-ПЛР, клонування); імунологічні (ELISA, Western-blot аналіз,
імуноцито- та імуногістохімія); радіоізотопні (визначення включення
3Н-тимідина); метод культури клітин.

Наукова новизна одержаних результатів. Розроблено схему отримання
біологічно активного рекомбінантного бета-дефенсина-2 людини з
використанням бактеріальної системи експресії. Методом соматичної
гібридизації отримано гібридому, що продукує моноклональні антитіла
проти молекули бета-дефенсина-2 людини. Вперше досліджено
концентраційно-залежний вплив рекомбінантного бета-дефенсина-2 людини на
проліферацію та життєздатність пухлинних клітин епітеліального
походження in vitro. Встановлена зворотня залежність між концентрацією
hBD-2 та його впливом на рівень фосфорилювання рецептора ЕФР in vitro.
Досліджено експресію гена hBD-2 та особливості продукції
бета-дефенсина-2 в пухлинах шлунка та шийки матки людини. Встановлена
залежність між продукцією бета-дефенсина-2 та ступенем трансформації
епітелія шийки матки людини, що може бути використано як додатковий
маркер в діагностиці неоплазій цієї локалізації.

Практичне значення одержаних результатів. Робота представляє собою
фундаментальне дослідження, результати якого можуть бути використані для
розробки нових підходів в діагностиці пухлинних процесів. Ідентифікація
антигена з використанням анти-hBD-2 моноклональних антитіл в
епітеліальних пухлинах шийки матки людини може бути запропонована в
якості додаткового маркера в діагностиці неоплазії шийки матки.

Особистий внесок здобувача. Автором особисто зібрана та проаналізована
література за темою дисертації, обгрунтовані адекватні методи
досліджень. Всі дослідження виконувались при безпосередній участі
здобувача. Здобувачем особисто проведені експерименти in vitro та
визначення експресії гена hBD-2 на рівні мРНК.

Апробація результатів дисертації. Основні положення дисертації були
представлені та обговорені на: 5-й Парнасівській конференції “Molecular
mechanisms of cellular signalling” (Україна, Київ, 2005);
науково-практичній конференції “Нові технології в діагностиці та
лікуванні хворих на онкогінекологічні захворювання” (Україна, Одеса,
2004); 4-й Парнасівській конференції “Molecular mechanisms of cell
activation: biological target enzymes” (Польща, Вроцлав, 2002); Х-му
з’їзді онкологів України (Україна, Крим, 2001); Міжнародному симпозіумі
„Intracellular Signalling in Plant and Animal Systems” (Україна, Київ,
2001); 18-му Міжнародному конгресі по біохімії та молекулярній біології
(Великобританія, Бірмінгем, 2000); 26–й конференції Європейського
,біохімічного товариства (Франція, Ніца, 1999).

Публікації. Основні положення дисертації викладені в 15 наукових
роботах, з яких 7 статей надруковані в провідних фахових виданнях,
рекомендованих ВАК України та 8 тез у збірках конференцій, симпозіумів
та з’їздів.

Структура та обсяг дисертації. Дисертація складається із вступу, огляду
літератури, розділу матеріали і методи дослідження, семи розділів
власних досліджень, аналізу та узагальнення отриманих результатів,
висновків і списка використаної літератури. Основний зміст дисертації
викладений на 150 сторінках машинописного тексту, містить 5 таблиць та
44 рисунка. Список використаної літератури включає 202 джерела, з них 12
вітчизняних та 190 іноземних авторів.

ОСНОВНИЙ ЗМІСТ РОБОТИ

Матеріали та методи дослідження. В роботі було використано наступні
лінії клітин людини: M-HeLa (карцинома шийки матки), KB (епідермоїдна
карцинома слизової оболонки ротової порожнини), A 431 (епідермоїдна
карцинома вульви) та MCF-7 (фіброцистома молочної залози).

Аналіз експресії гена hBD-2 та продукції пептида методами ЗТ-ПЛР та
імуногістохімії проведено на зразках хірургічно видалених пухлин шлунка:
стадія Т2 (n=2), стадія Т3 (n=9), стадія Т4 (n=6) та умовнонормальних
тканин шлунка (n=17), отриманих в Інституті онкології АМН України (зав.
науково-дослідним відділенням абдомінальної онкології проф. Шалімов
С.О.). Зразки цих же тканин було використано для приготування
гістологічних препаратів.

Імуногістохімічний аналіз продукції hBD-2 в зразках епітелія шийки матки
проведено на гістологічних препаратах, люб`язно наданих к.б.н.
Лізогубовим В.В.: плоскоклітинна карцинома in situ (стадія Т0) (n=15);
плоскоклітинна карцинома (стадія Т1а) (n=15); в якості контролю
використовували тканини шийки матки, отримані після оперативного
лікування неонкологічних захворювань(n=10) (Морфологічна лабораторія
БіоНТЕК, м. Дніпропетровськ). Гістологічний тип пухлин визначали згідно
класифікації ВООЗ. Пацієнти були проінформовані та дали згоду на
використання хірургічного матеріалу в дослідницьких цілях.

Клонування фрагмента кДНК, що кодує біологічно активний hBD-2, проводили
за стандартними методиками (Маниатис Т. и др., 1984).

Аналіз експресії GST-злитого рекомбінантного білка та вибір умов
культивування бактеріальної культури проводили згідно протоколу GST
fusion expression system (Novagene, США). Розробку схеми очистки
рекомбінантного hBD-2 проводили на основі класичних хроматографічних
методів.

Отримання гібридних клітин, що продукують моноклональні антитіла проти
hBD-2, проводили шляхом соматичної гібридизації згідно протоколу
(Antibodies. A Laboratory Manual, E.Harlow, D.Lane, 1988).

Характеристику та визначення специфічності отриманих моноклональних
антитіл проводили із застосуванням імуноферментного методу (ELISA),
імуноцитохімічного аналізу та Вестерн-блот аналізу.

Для досліджень екзогенного впливу рекомбінантного hBD-2 in vitro на
клітини ліній A-431, M-HeLa, KB та MCF-7 останні культивували в
середовищі DMEM або RPMI-1640 (Gibco BRL, Великобританія) з додаванням
10% ембріональної сироватки крові великої рогатої худоби (Gibco BRL,
Великобританія).

Визначення мітогенної дії hBD-2 оцінювали по включенню 3Н-тимідина в ДНК
клітин, які синхронізували пересіванням та культивували в 96-лункових
планшетах в безсироватковому середовищі протягом 18 годин. Клітини
знімали розчином 0,25% трипсину, наносили на ацетатні фільтри та
проводили підрахунок радіоактивності, використовуючи бета-лічильник
Beckman 5801 LS(США).

Для аналізу експресії гена hBD-2 в реакції ЗТ-ПЛР використовували
специфічні олігонуклеотидні затравки: 5(-gaagctcccagccatcagcc – пряма та
5(-gtcgcacgtctctgatgaggga – зворотня, а також набір реактивів First
Strand cDNA Synthesis Kit (№К1621, MBI Fermentas, Литва). Реакцію
проводили згідно з протоколом виробника в об’ємі 20 мкл з використанням
набору для синтезу кДНК RevertAidTM, First Strand cDNA Synthesis Kit
(№К1621, MBI Fermentas, Литва).

Для контролю перебігу ЗТ-ПЛР та для визначення співвідношення рівня
експресії гена hBD-2 в тканинах пухлин шлунка та умовно нормального
епітелія слизової оболонки шлунка використовували оцінку експресії гену
гліцеральдегід-3-фосфат дегідрогенази (G3PDH). Використовували наступні
олігонуклеотидні затравки до даного гена: пряма —
5(-tgaaggtcggagtcaacggatttggt та зворотня — 5(-catgtgggccatgaggtccaccac.

Полімеразну ланцюгову реакцію проводили з використанням ампліфікатора
Gene Amp PCR System 2400 (Perkin Elmer, США) та термостабільної Taq
ДНК-полімерази (№ЕР0401, MBI Fermentas, Литва) згідно з протоколом
виробника. Ампліфікація фрагмента кДНК гена hBD-2 проводилась протягом
35 циклів при оптимальних умовах: денатурація – 950С протягом 45 с,
асоціація праймерів з матрицею — 640С протягом 30 с, синтез при 720С
протягом 30 с.

Аналіз продуктів ампліфікації проводили за допомогою електрофорезу в
агарозному або поліакриламідному гелях (Маниатис Т. и др., 1984).

Для визначення фосфокіназної активності ЕФР-рецептора та мітоген-
активованих кіназ ЕФР-рецепторного сигнального каскаду білкові лізати
клітин фракціонували електрофоретично в системі буферів Леммлі з
використанням 7-22% градієнтних поліакриламідних гелів товщиною 1 мм,
застосовуючи апарат “Біорух” (Україна). Після електрофорезу білки
переносили на нітроцелюлозну мембрану (Schleicher & Schuell, Німеччина).
Інкубацію нітроцелюлозних фільтрів проводили в розчині ТBS, що містив
0,1% детергента Tween-20. Візуалізацію фосфорильованих білків
здійснювали з використанням набору ECL (RPN2106, Amersham,
Великобританія) згідно протоколу виробника.

Для імуногістохімічного аналізу зразки пухлин фіксували в розчині Буена
24 години при кімнатній температурі, зберігали в 70% етанолі, та
зневоднювали в спиртах зростаючої концентрації, насичували парафіном при
56оС. Блоки пухлинних та контрольних тканин використовували для
виготовлення зрізів товщиною 5 (м на мікротомі REICHERT-JUNG Mod.
1140/Autocut.

Імуногістохімічне дослідження проводили на парафінових зрізах методом
непрямого виявлення антигену з використанням авідин-біотинової системи
(M. Ferencik, 1993). Неспецифічну адсорбцію блокували, використовуючи
Biotin blocking system (DAKO, Данія). Анти-hBD-2 моноклональні антитіла
в титрі 1 : 100 використовували як первинні антитіла. В якості вторинних
антитіл використовували авідин-біотинову систему (Vectastain ABC Kit,
Vecor Lab, США). Ядра клітин дофарбовували гематоксиліном Мейера. Як
негативний контроль використовували зрізи, оброблені 1% розчином БСА та
сироватку крові миші в розведенні 1 : 2000. Мікроскопічне дослідження
проводили на мікроскопі Axioplan, що містить систему цифрового аналізу
зображень. Для оцінки рівня досліджуваного параметра використовували
наступну оціночну шкалу: 0 = немає забарвлення, 1 = слабке забарвлення,
2 = помірне забарвлення, 3 = інтенсивне забарвлення.

Статистичну обробку результатів проводили з використанням критерію
Стьюдента та непараметричних методів аналізу.

РЕЗУЛЬТАТИ ДОСЛІДЖЕНЬ ТА ЇХ ОБГОВОРЕННЯ

Для отримання рекомбінантного бета-дефенсина-2 людини фрагмент кДНК гена
(148 п.н.), що кодує біологічно активну молекулу бета-дефенсина-2
людини, було отримано з тотальної РНК клітин А-431, індукованих ЕФР, за
допомогою ЗТ-ПЛР з використанням олігонуклеотидних затравок наступного
нуклеотидного складу: 5` — gtgttggatccggtataggcgatcctgttacctg – пряма,
що містить BamHI сайт, та 5` — tcttggaattctcatggctttttgcagcattttg –
зворотня, що містить EcoRI сайт. Отриманий фрагмент було клоновано по
вищевказаним сайтам рестрикції в полілінкер експресуючого вектора
pGEX-2T.

Було встановлено, що рекомбінантний GST-hBD-2 злитий білок є розчинним,
а оптимальними умовами його продукції є індукція бактеріальної культури
0,5 мМ IPTG після досягнення оптичної густини OD610=1.0 протягом 6 год
при 370С.

Після встановлення оптимальних умов продукції злитого білку було
розроблено схему ефективної очистки біологічно активного рекомбінантного
бета-дефенсина-2 людини. Дана схема включає в себе наступні етапи: 1)
очистка GST-hBD-2 злитого білку шляхом афінної хроматографії на колонці,
що містить глутатіон-сефарозу в якості носія (елюцію здійснювали
буфером, що містить 50 мМ Tris-HCl, pH 7,6; 250 мМ NaCl; 5 мM DTT, що
містив 10 мМ глутатіона); 2) протеолітичне розщеплення злитого білку
тромбіном (додавання тромбіну у співвідношенні 1 од. акт. на 1 мг
рекомбінантного білку повністю розщеплює злитий білок протягом 12 год
при 40С) (Рис.1); 3) очистка активного бета-дефенсина-2 за допомогою
гель фільтрації з використанням колонки Superose-300 Amersham, що
містить сефакрил в якості носія, в буфері наступного складу: 20 мМ
Тріс-НСl, рН 7.6; 20 мМ NaCl; 5 мМ в-меркаптоетанол. Електрофоретичний
аналіз фракцій, зібраних під час гель-фільтрації, дозволив встановити,
що використання такого підходу дає можливість очистити бета-дефенсин-2
від залишків тромбіна та глутатіон-S-трансферази. Очищений по даній
схемі активний бета-дефенсин-2 використано в подальших експериментах in
vitro.

а б б

Рис. 1. Електрофореграма GST-hBD-2 злитого білку після афінної
хроматографії (а) та hBD-2 після гель-фільтрації на колонці Superose-300
(б); М – маркер молекулярної маси.

Імунізацію мишей лінії Balb/C проводили отриманим в роботі злитим
рекомбінантним білком. Шляхом соматичної гібридизації було створено
гібридні клітини, що продукують моноклональні антитіла проти
бета-дефенсина-2. Скринування первинних клонів було проведено
імуноферментним методом (ELISA) для ідентифікації клонів, що продукують
анти-hBD-2 антитіла. Методом імуноцитохімії з використанням
флуоресцентно міченого антимишиного коньюгату було встановлено, що 100%
отриманих гібридомних клітин продукують анти-hBD-2 МКАТ. З метою
напрацювання анти-hBD-2 МКАТ клітини клонів було трансплантовано мишам
та отримано асцитну рідину. Висолені ацетатом амонія з асцитної рідини
антитіла після діалізу було використано в подальших дослідженнях. Було
встановлено, що отримані анти-hBD-2 антитіла є специфічними до
бета-дефенсина-2, не проявляють кросс-реактивності по відношенню до
бета-дефенсинів 3 та 4 людини та можуть бути застосовані в основних
імунологічних методах досліджень, таких як ELISA, Dot-blot,
Western-blot, імуноцито- та імуногістохімія.

Приймаючи до уваги, що біологічні ефекти дефенсинів людини можуть
залежати від їх концентрації, було поставлено задачу дослідити вплив
бета-дефенсина-2 на життєздатність трансформованих клітин ліній А431та
M-HeLa в широкому діапазоні концентрацій.

Вплив рекомбінантного бета-дефенсина-2 на життєздатність пухлинних
клітин було оцінено за допомогою МТТ-тесту. Аналіз отриманих даних
дозволив встановити, що вплив бета-дефенсина-2 на життєздатність клітин
А431 та М-HeLa демонструє дозо-залежний ефект (Рис 2).

Рис. 2. Вплив hBD-2 на життєздатність культивованих
злоякісно-трансформованих клітин епітеліального походження. (Вісь ОY —
рази збільшення числа життєздатних клітин)

Нами показано, що інкубація клітин з бета-дефенсином-2 в
концентраціях до 2 мкг/мл (0,5 мкМ) приводила до збільшення числа живих
клітин в порівнянні з контрольними клітинами, що інкубували з рівним
об’ємом PBS в 1,5-1,7 рази. Вищі концентрації дефенсина призводили до
поступового зменшення життєздатності клітин, що спостерігалося при
концентраціях дефенсину > 3 та >5 мкг/мл для клітин ліній HeLa та А431,
відповідно. Морфологічні дослідження показали, що клітини, які
інкубували в присутності 1-2 мкг/мл (0,25-0,5 мкМ) hBD-2, формували
щільний моношар, як і клітини, що культивували в присутності 10%
ембріональної сироватки великої рогатої худоби, та проявляли високі
адгезивні властивості (були стійкими до дії 0,25% розчину трипсину). При
інкубації клітин з hBD-2 в концентрації 60 мкг/мл (15 мкМ) клітини
округлювалися, втрачали міжклітинні контакти, а їх адгезивні властивості
зменшувалися.

Результати прямого підрахунку клітин підтвердили дані МТТ-тесту і
продемонстрували значне (майже в 1,5 рази) підвищення числа клітин
А-431, що інкубували з дефенсином в концентрації 2 мкг/мл (0,5 мкМ).
Таким чином, було встановлено, що в концентраціях < 0,5 мкМ бета-дефенсин-2 стимулював ріст культивованих клітин. Наступною задачею нашого дослідження було визначення мітогенного впливу hBD-2 на клітини епітеліального походження in vitro. Для вивчення мітогенного впливу бета-дефенсина-2 на пухлинні клітини обрано лінії клітин А431, M-HeLa, KB та MCF-7, що несуть на своїй поверхні різну кількість молекул ЕФР-рецептора. Було встановлено (Рис. 3), що бета-дефенсин-2 в концентрації 0,5 мкМ достовірно підвищував проліферативну активность клітин ліній А431, M-HeLa та КВ, в яких кількість ЕФР-рецептора > 105 молекул ЕФРр на клітину.

Рис. 3. Включення 3Н-тимідина в ДНК культивованих клітин при дії 0,5 мкМ
бета-дефенсина-2.

В такій же концентрації бета-дефенсин-2 не викликав мітогенної дії на
клітини лінії MCF-7, в яких кількість ЕФР-рецептора становить < 103 молекул ЕФРр на клітину). Оскільки відмічено різний рівень проліферативної активності клітин епітеліального походження з різним вмістом ЕФР-рецептора при дії бета-дефенсина-2, було висунуто припущення про можливу участь в стимуляції проліферації ЕФР-рецептора - ключової молекули, що опосередкує дію мітогенів на епітеліальні клітини. " R : ^ – E I ? i ? & R 8 : b f – ? i ? o ??&? ,ктер. Методом Вестерн-блот аналізу з використанням анти-фосфотирозинових антитіл (PY20) було встановлено, що 30 хв інкубація клітин з бета-дефенсином-2 викликає транзиторне підвищення фосфорилювання ЕФР-рецептора, рівень якого має зворотню залежність від концентрації hBD-2 в середовищі. При дії hBD-2 в концентраціях, нижчих за 0,5 мкМ, спостерігалось підвищення фосфорилювання ЕФР-рецептора (хоча на набагато нижчому рівні, ніж таке при дії 10 нг ЕФР). При дії hBD-2 в концентраціях вищих за 15 мкМ, навпаки - пригнічення цього показника. В концентрації 0,5 мкМ hBD-2 викликає активацію кіназ MEK1/2 та ERK1/2 (Рис. 4). Рис. 4 Фосфорилювання MEK1/2, JNK1/2, ERK1/2 при дії 0,5 мкМ бета-дефенсина-2 на клітини А431. Таким чином, дослідження in vitro продемонстрували, що біологічна дія бета-дефенсина-2 та процеси, які викликає даний пептид залежить від його концентрації. а експресія цього пептидного антибіотика має індуцибельний характер у відповідь на бактерії та медіатори запалення. Дослідження експресії бета-дефенсина-2 в пухлинах шлунка людини, що було проведено нами, є першою спробою встановити можливу участь цього пептида в злоякісній трансформації шлункового епітелія. Аналіз експресії hBD-2 на рівні мРНК та білка в злоякісно трансформованому епітелії шлунка було проведено методом ЗТ-ПЛР та імуногістохімії на 17 зразках хірургічно видалених пухлин шлунка та макроскопічно незміненої слизової (Табл. 1). Таблиця 1 Експресія hBD-2 в зразках пухлин шлунку людини № п/п Гістологі-чний тип пухлин Ступінь диференці-ювання TNM Експресія мРНК hBD-2 Імуногісто-хімічне виявлення білка Н П Н П 1 AC G4 T4N2M0 - - - - 2 AC G3 T3N2M0 - + - + 3 АС G3 T3N0M0 - + - + 4 AC G4 T3N2M0 - - - - 5 АС G2 T3N1M0 - - - - 6 АС G2 T3N0M0 + + + + 7 AC G3 T3NxM0 - + - + 8 AC G4 T3N2M0 + + + + 9 AC G2 T2N1M0 + + + + 10 AC G3 T4N0M0 - + - + 11 АС G4 T3N1M0 + + + + 12 AC G4 T3N2M0 + + + + 13 AC G3 T4N0M0 + - + - 14 AC G4 T2N0M0 - - - - 15 AC G3 T4N0M0 - + - + 16 AC G2 T4N2M1 - + - + 17 AC G2 T4N1M0 - - - - AC – аденокарцинома, G2 – помірно диференційовані пухлини, G3 – низько диференційовані пухлини, G4 – недиференційовані пухлини. (Н –нормальна слизова, П – пухлина.) Аналіз даних, після проведення ЗТ-ПЛР дозволив встановити певні закономірності щодо експресії бета-дефенсину-2 в пухлинах шлунка: 1)експресія мРНК hBD-2 відповідала продукції білка, що було підтверджено імуногістохімічним дослідженням; 2) в пухлинах експресія hBD-2 відмічалась в 65% випадків. Найчастіше ці пухлини були помірного та низького ступеня диференціювання та недиференційовані. На основі отриманих даних можна говорити про тенденцію експресії бета-дефенсина-2 в аденокарциномах цих ступенів диференціювання. В нормальній слизовій оболонці шлунка наявність експресії hBD-2 спостерігалась лише в поверхневих шарах епітелія, клітини якого знаходяться під впливом багатьох екзогенних та ендогенних факторів. Білок ідентифікувався у вигляді гранул біля апікальної поверхні клітин, тоді як в аденокарциномах шлунка 2, 3, та 4 стадій продукція hBD-2 відмічена по всій зоні пухлин, в клітинах пептид локалізований дифузно переважно під цитоплазматичною мембраною. В помірно-диференційованих пухлинах характер експресії hBD-2 нагадує такий як в нетрансформованих тканинах - гранульоване забарвлення (наявність вакуоль), а в низько- та недиференційованих аденокарциномах експресія бета-дефенсину-2 була виявлена під цитоплазматичною мембраною клітин. Раніше нами було встановлено, що клітини пухлин шийки матки характеризуються гіперекспресією гена hBD-2 в порівнянні з нетрансформованим епітелієм шийки матки. Приймаючи до уваги вищу інформативність імуногістохімічного дослідження експресії цього маркера в порівнянні з таким ЗТ-ПЛР, наступним етапом роботи стало дослідження експресії бета-дефенсина-2 в пухлинах шийки матки імуногістохімічним методом з використанням анти-hBD-2-МКАТ. Для дослідження були використані зразки хірургічно видалених пухлин шийки матки (плоскоклітинна карцинома in situ (стадія Т0) (n=15); плоскоклітинна карцинома (стадія Т1а) (n=15)) та тканини шийки матки, отримані після оперативного лікування хворих з неонкологічною патологією (n=10) (Табл. 2). Рівень продукції бета-дефенсина-2 в різних шарах цервікального епітелія (поверхневому, проміжному та базальному/парабазальному) оцінювали напівкількісним методом використовуючи оціночну шкалу від 0 до 3. Паралельно проводили імуногістохімічне дослідження рівня експресії ядерного антигена клітин, що проліферують (PCNA), який є маркером проліферативної активності клітин. Як показав аналіз отриманих даних, в контрольних зразках експресію hBD-2 було виявлено в 3 з 10 досліджених зразків, причому в цих випадках експресію дефенсину було відмічено в цитоплазмі клітин базального шару епітелія, яка була представлена інтенсивно забарвленими малими гранулами або слабким дифузним забарвленням цитоплазми. В поверхневому та проміжному шарах епітелія слабка експресія була відмічена в цитоплазмі лише поодиноких клітин (ступінь забарвлення 0-1). Таким чином, нетрансформованому епітелію шийки матки властива відсутність або низький рівень експресії бета-дефенсину-2. Імуногістохімічний аналіз hBD-2 показав, що в зразках плоскоклітинної карциноми in situ значно збільшена інтенсивність імуногістохімічної реакції на hBD-2 в цитоплазмі епітеліальних клітин у всіх шарах епітелія шийки матки (індекс 2 або 3) та статистично достовірно в порівнянні з контролем р<0,05 (статистичні дані наведено в таблиці 2). Цитоплазматична локалізація білка мала переважно дифузний характер, в деяких клітинах продукти реакції були локалізовані в ядрі, а також в стромі. Таблиця 2 Імуногістохімічний аналіз експресії hBD-2 та PCNA в епітеліальних клітинах шийки матки Інтенсивність імуногістохімічної реакції маркер Контроль (n = 10) Стадія Т0 (n = 15) стадія ТIa (n = 15) Поверхневий шар епітелія Ядра PCNA 0 1.13 ± 0.37* 1.82 ± 0.28* hBD-2 0 0.13 ± 0.13 0.17 ± 0.12 Цитоплазма PCNA 0 0.50 ± 0.20* 0.91 ± 0.22* hBD-2 0.46 ± 0.196 2.25 ± 0.34* 1.50 ± 0.27* Проміжний шар епітелія Ядра PCNA 0 2.00 ± 0.40* 2.69 ± 0.14* hBD-2 0 0.11 ± 0.12 0.23 ± 0.13 Цитоплазма PCNA 0 0.88 ± 0.31* 1.31 ± 0.27* hBD-2 0.69 ± 0.223 2.00 ± 0.31* 1.77 ± 0.24* Базальний та пара базальний шар епітелія Ядра PCNA 1.00 ± 0.00 1.63 ± 0.35* 2.31 ± 0.27* hBD-2 0 0.13 ± 0.13 0.23 ± 0.13 Цитоплазма PCNA 0.38 ± 0.36 0.88 ± 1.38 1.38 ± 0.25* hBD-2 1.00 ± 0.27 2.25 ± 0.27* 1.77 ± 0.21* Примітки: Різниця є достовірною (Р<0,05) в порівнянні з показником контрольної групи за t та U-критеріями; * - відмінності між средніми значеннями параметрів в відсотках. Імуногістохімічне дослідження експресії hBD-2 у зразках плоскоклітинної карциноми шийки матки (Т1А) виявило достовірне збільшення експресії дефенсина в цитоплазмі пухлинних клітин у порівнянні з контролем в усіх шарах епітелія (Табл. 2), хоча між групами Т0 та Т1А статистично достовірної різниці не виявлено. В зразках плоскоклітинної карциноми шийки матки (Т1А) було виявлено різні варіанти локалізації продукції бета-дефенсина-2: в деяких випадках вона була цитоплазматичною та переважно локалізовалась під цитоплазматичною мембраною, в інших випадках – переважно в ядрах. Кількісні параметри експресії hBD-2 однакові в клітинах пухлин стадій Т0 та Т1А, але в клітинах стадії Т1А відмічалось позитивне забарвлення ядер або локалізація антигену під цитоплазматичною мембраною. Аналіз отриманих даних виявив, що в клітинах пухлин стадії Т1А гіперекспресія hBD-2 та PCNA не мають корелятивної залежності (Рис. 5). Контрольна група Стадія Т0 Стадія Т1А (неонкологічні хворі) Рис. 5 Гістограми розподілу експресії бета-дефенсина-2 (?) та PCNA (?) в зразках тканин шийки матки. ПШ – поверхневий шар епітелія, ПрШ – проміжний шар епітелія, БШ – базальний шар епітелія. По осі ОХ – оціночна шкала. Таким чином, нами виявлено, що клітинам плоскоклітинної карциноми шийки матки ранніх стадій властива гіперекспресія hBD-2 в порівнянні з нетрансформованим епітелієм шийки матки. ВИСНОВКИ В результаті проведеної роботи отримано рекомбінантний бета-дефенсин-2 людини та моноклональні антитіла, що дозволяють проводити аналіз продукції бета-дефенсина-2 в різних тканинах організма. 1. Встановлено, що рекомбінантний бета-дефенсин-2 має концентраційно-залежний вплив на життєздатність та проліферацію клітин епітеліального походження А431, M-HeLa, KB та MCF-7. 2. В концентрації до 0,5 мкМ hBD-2 стимулює, а в концентраціях, вищих за 0,5 мкМ – пригнічує проліферацію культивованих епітеліальних клітин. 3. Встановлена зворотня залежність між концентрацією hBD-2 та його впливом на рівень фосфорилювання рецептора ЕФР in vitro. 4. Методом ЗТ-ПЛР аналіза та імуногістохімічним методом з використанням анти-hBD-2-антитіл експресія бета-дефенсина-2 виявлена в 65% аденокарцином шлунка людини. 5. Продемонстровано, що клітинам плоскоклітинної карциноми шийки матки людини стадій Т0 та Т1А властива гіперекспресія hBD-2 в порівнянні з нетрансформованим епітелієм шийки матки. СПИСОК ПРАЦЬ, ОПУБЛІКОВАНИХ ЗА ТЕМОЮ ДИСЕРТАЦІЇ 1. Markeeva N., Lisovskiy I., Soldatkina M., Lyzogubov V., Potapov V., Usenko V., Pogrebnoy P. Involvement of hBD-2 in proliferation of malignant human cervical epithelial cells.// Experimental Oncology. – 2005. – V. 27, №4. – P.308-313. (Особистий внесок дисертанта: дослідження in vitro по визначенню дії рекомбінантного бета-дефенсина-2 на життєздатність та проліферацію культивованих клітин та статистичну обробку даних проводила особисто, приймала участь в написанні і оформленні статті). 2. Markeeva N., Lisovskiy I., Lyzogubov V., Usenko V., Soldatkina M., Merentsev S., Zaitsev S., Kondratskii Y., Tofan A., Osinskiy S., Pogrebnoy P. Expression of beta-defensin-2 in human gastric tumors.// Experimental Oncology. – 2005. – V. 27, №2. – P.130-135. (Особистий внесок дисертанта: у співавторстві з Погрібним П.В. отримала гібридому, що продукує моноклональні антитіла проти бета-дефенсина-2, обробила та оформила наукові результати, приймала участь у написанні статті). 3. Pogribnoy P.V., Lisovskiy I.L., Markeeva N.V., Shnitsar V.M., Zinchenko I.I., Soldatkina M.A. Produсtion of recombinant of hBD-2 – human antimicrobial peptide expressed in cervical and vulval cancer // Экспериментальная онкология. – 2003. – Т.25, №1. – С.36-39. (Особистий внесок дисертанта: виконувала експериментальні дослідження та обробку наукових результатів). 4. Hobta A.I., Lisovskiy I.L., Mikhalap S., Kolybo D., Romanyuk S., Soldatkina М., Markeeva N., Garmanchouk L., Sidorenko S., Pogrebnoy P.. Epidermoid Carcinoma derived Antimicrobial Peptide (ECAP) inhibits phosphorylation by protein Kinases in vitro // Cell biochemistry and function. – 2001. – №19. – Р.291-298. (Особистий внесок дисертанта: проводила культивування злоякісно трансформованих клітин, отримала лізати клітин та зразків тканин). 5. Lisovskiy I.L., Soldatkina M.A., Lytvyn D.I., Markeeva N.V., Turchak O.V., Nespryad’ko S.V., Vinnitskaya A.B., Nosach L.N., Povnitsa O.U., Pogrebnoy P.V. Pattern of expression of beta-definsin-2 (hBD-2) and EGFR mRNA in malignant cells of human cervix and vulvae // Экспериментальная онкология. – 2001. – Т.23, №4. – С.248-252. (Особистий внесок дисертанта: приймала участь в отриманні РНК із зразків пухлинних тканин). 6.Lisovskiy I.L., Soldatkina M.A., Lytvyn D.I., Markeeva N.V., Turchak O.V., Nespryad’ko S.V., Vinnitskaya A.B., Pogrebnoy P.V. Expression of defensins genes in А431 and М-Hela cell lines and in tumors of human vulval and cervical carcinoma // Экспериментальная онкология. – 2001. – Т.23, №2. – С.119-122. (Особистий внесок дисертанта: проводила культивування злоякісно трансформованих клітин, отримала РНК із зразків пухлинних тканин). Лісовський І.Л., Маркеєва Н.В., Хобта А.І., Литвин Д.І., Сидорик Л.Л., Солдаткіна М.А., Погрібний П.В. Експресія гена дефенсину-6 (HD-6) у лініях пухлинних клітин людини// Биополимеры и клетка. – 2000. – Т.16, №6. – С.525-529. (Особистий внесок дисертанта: виконувала експериментальні дослідження та приймала участь в обговоренні результатів). 8. Lisovskiy I.L., Markeeva N.V., Soldatkina M.O., Pogribnoy P.V. Recombinant human beta-defensin-2 is mimicking action of EGF in epithelial cells in vitro// 5th Parnas Conference Molecular mechanisms of cellular signalling. – Ukraine, Kiev, 2005. – P.202. 9. Маркєєва Н.В., Солдаткіна М.О., Лісовський І.Л., Погрібний П.В., Лізогубов В.В., Усенко В.С., Вінницька А.Б., Неспрядько С.В., Турчак А.В. Експресія в-дефенсинів в пухлинах шийки матки та вульви // Матер. Науково - практичної конф. Нові технології в діагностиці та лікуванні хворих на онкогінекологічні захворювання.– Україна, Одеса, 2004. – С.11-15. 10.Soldatkina M.A., Markeeva N.V., Lisovskiy I.L., Podrebnoy P.V. Defensin and EGFR expression in human cervical, vulval and gastric tumors// 4th Parnas Conference. Molecular mechanisms of cell activation: biological target enzymes. – Польща, Вроцлав, 2002. – Р. 55. Pogrebnoy P.V., Markeeva N.V., Lisovskiy I.L., Soldatkina M.A. Defensin and EGFR mRNA expression in transformed human cells// 4th Parnas Conference Molecular mechanisms of cell activation: biological signals and their target enzymes. – Польща, Вроцлав, 2002. – Р. 70. Л.В.Гарманчук, В.Е.Чешук, П.В.Погребной, Маркеєва Н.В., Н.Ф.Аникусько, В.В.Зайчук, А.И.Хобта. Количественное определение рецептора эпидермального фактора роста и белка-супрессора Р53 в опухолях молочной железы с использованием метода иммунопреципитации специфическими антителами// Матеріали Х з’їзду онкологів України. – Крим, 2001. – С.36-37. Lisovskiy I.L., Soldatkina M.A., Lytvyn D.I., Markeeva N.V., Nosach L.N., Povnitsa O.U., Pogrebnoy P.V. Expression pattern of defensin genes in cervical and vulval cancer cells// Intern.Sympos.Intracellular Signalling in Plant and Animal Systems. – Ukraine, Kyiv, 2001. – Р.76. Lisovskiy I., Hobta A., Soldatkina M., Garmanchouk L., Markeeva N., Lytvyn D., Pogribnyi P. Detection of mRNA for beta-defensin 2 in human cell lines of epithelial origin// 18th International Congress of Biochemistry and Molecular Biology. – Birmingham, 2000. – Р. 162. 15. Hobta A., Lisovskiy I., Soldatkina M., Markeeva N., Pogrеbnoy P. Inhibition of the protein kinases by ECAP// 26th Meeting of the Federation of European Biochemical Societies. – Nice, 1999. – Р. 256. АНОТАЦІЯ Маркєєва Н.В. Бета-дефенсин-2 в злоякісно трансформованих клітинах епітеліального походження. – Рукопис. Дисертація на здобуття наукового ступеня кандидата біологічних наук за спеціальністю 14.01.07 – Онкологія. – Інститут експериментальної патології, онкології і радіобіології ім. Р.Є. Кавецького НАН України, Київ – 2006. Дисертація присвячена дослідженню впливу рекомбінантного бета-дефенсина-2 людини, на життєздатність та проліферацію злоякісно трансформованих клітин in vitro та особливостей експресії hBD-2 на рівні мРНК та білка в пухлинах шлунка та шийки матки людини. В експериментах in vitrо було показано, що рекомбінантний hBD-2, який був експресований в бактеріальній системі є біологічно активним пептидом, а його вплив на життєздатність культивованих злоякісно трансформованих клітин має дозо-залежний характер: в концентраціях нижче 0,5 мкМ пептид стимулює, а у вищих за 0,5 мкМ – пригнічує життєздатність клітин. Інкубація клітин з бета-дефенсином-2 впливає на морфологні та адгезивні властивості злоякісно трансформованих клітин ліній А431 та HeLa. Встановлено, що в концентрації до 0,5 мкМ hBD-2 стимулює, а в концентраціях вищих 0,5 мкМ – пригнічує проліферацію культивованих епітеліальних клітин. Було показано, що дія hBD-2 на рівень фосфорилювання рецептора ЕФР в злоякісно трансформованих клітинах має концентраційно-залежний характер. Методами ЗТ-ПЛР аналіза та імуногістохімії з використанням анти-hBD-2-антитіл було показано, что в 65% пухлин шлунка виявлена експресія бета-дефенсина-2 на рівні мРНК та білка. В клітинах карциноми in situ та плоскоклітинної карциноми шийки матки стадії Т1А гіперекспресія hBD-2 відмічена у всіх шарах епітелія в порівнянні з нетрансформованим епітелієм шийки матки. Ключові слова: бета-дефенсин-2, ген hBD-2, ЕФР-рецептор, проліферація, моноклональні антитіла, пухлини шлунка, пухлини шийки матки. АННОТАЦИЯ Маркеева Н.В. Бета-дефенсин-2 в злокачественно трансформированных клетках эпителиального происхождения. – Рукопись. Диссертация на соискание ученой степени кандидата биологических наук по специальности 14.01.07 – Онкология. – Інститут экспериментальной патологии, онкологии и радиобиологии им. Р.Е. Кавецкого НАН Украины, Киев – 2006. Диссертация посвящена исследованию биологической роли рекомбинантного бета-дефенсина-2 человека, а именно его влияния на жизнеспособность и пролиферацию злокачественно трансформированных клеток in vitro, а также особенностей экспрессии hBD-2 на уровне мРНК и белка в опухолях желудка и шейки матки человека. Активный рекомбинантный бета-дефенсин-2 был экспрессирован в бактериальной системе, очищен и использован в качестве антигена для получения гибридных клеток, продуцирующих моноклональные антитела против hBD-2. В экспериментах in vitro было продемонстрировано, что рекомбинантный hBD-2 является биологически активным пептидом, который может оказывать разнонаправленное действие на различные показатели культивированных клеток. В зависимости от концентрации бета-дефенсин-2 либо стимулирует, либо ингибирует жизнеспособность и пролиферацию злокачественно трансформированных клеток линий А431 и HeLa. Морфологические исследования показали, что клетки, которые инкубировали в среде с 1-2 мкг/мл (0,25-0,5мкМ) бета-дефенсина-2, формируют плотный монослой и отличаются высокими адгезивными свойствами (были устойчивы к действию 0,25% трипсина). Показано, что в концентрации ниже 0,5 мкМ hBD-2 стимулирует, а в концентрациях выше 0,5 мкМ – ингибирует пролиферацию культивированных эпителиальных клеток. Статистически достоверное повышение пролиферации при действии бета-дефенсина-2 было отмечено в тех линях клеток, для которых характерна повышенная экспрессия ЭФР-рецептора на поверхности плазматической мембраны: А431 (P<0.001), M-HeLa (P<0.05) и КВ(P<0.001), однако пролиферацию клеток линии MCF-7 бета-дефенсин-2 не стимулирует. Это позволило предположить, что влияние бета-дефенсина-2 на пролиферацию культивированных епителиальных клеток может осуществляться опосредовано через рецептор ЭФР и ЭФР-рецепторный каскад передачи сигналов. Была показана обратная связь между концентрацией hBD-2 и его влиянием на уровень фосфорилирования рецептора ЭФР in vitro. В концентрациях ниже 0,5 мкМ hBD-2 вызывает повышение фосфорилирования рецептора ЭФР с последующей активацией киназ MEK1/2 та ERK1/2. Методами РТ-ПЦР анализа и иммуногистохимии с использованием анти-hBD-2-антител было продемонстровано, что 65% опухолей желудка характеризуются наличием экспрессии бета-дефенсина-2 на уровне мРНК и белка. Експрессия пептида была выявлена по всей зоне опухоли, внутриклеточно белок выявлялся под цитоплазматической мембраной опухолевых клеток. В нормальной слизистой желудка експрессия бета-дефенсина-2 отличалась от таковой в опухолях; белок был локализован в виде гранул в апикальной части клеток только поверхностного слоя слизистой. Иммуногистохимическое исследование експрессии hBD-2 в образцах карциномы шейки матки in situ показало значительное и статистически достоверное (р<0,05) повышение продукции hBD-2 в цитоплазме епителиальных клеток во всех слоях епителия по сравнению с контролем. Локализация белка в цитоплазме носила преимущественно диффузный характер, а в некоторых клетках белок был идентифицирован в ядре. В образцах плоскоклеточной карциномы шейки матки (Т1А) были отмечены разные варианты локализации бета-дефенсина-2: в одних случаях она была цитоплазматической и окраска выявлялась под цитоплазматической мембраной, в других – преимущественно в ядрах. Было установлено, что количественных различий продукции бета-дефенсина-2 в клетках плоскоклеточной карциномы шейки матки стадий Т0 и Т1А нет: во всех слоях епителия шейки матки даной патологии выявлена гиперэкспрессия hBD-2 по сравнению с нетрансформованным эпителием шейки матки. Ключевые слова: бета-дефенсин-2, ген hBD-2, ЭФР-рецептор, пролиферация, моноклональные антитела, рак желудка, рак шейки матки. ANNOTATION Markeeva N.V. Beta-defensin-2 in malignant transformed epithelial cells. – A manuscript. Dissertation for the candidate of biological sciences degree in speciality 14.01.07 – Oncology. – R.E. Kavetsky Institute of Experimental Pathology, Oncology and Radiobiology, NAS of Ukraine, Kyiv - 2006. The dissertation is aimed on the study of biological role of recombinant human beta-defensin-2, particularly its influence on viability and proliferation of malignant transformed epithelial cells in vitro, and the patterns of hBD-2 expression on the level of mRNA and protein in gastric and cervical cancers . Active recombinant beta-defensin-2 was expressed in bacterial system, purified and used as antigen for generation of hybridoma cells producing anti-hBD-2-monoclonal antibodies. As it was demonstrated in vitro, recombinant hBD-2 is biologically active peptide that may cause opposite effects on different indices of cultured cells in dependence of its local concentration. Such effects of beta-defensin-2 were observed toward viability, morphology and adhesion of malignant transformed cells of А431 and HeLa lines. It was shown that at the concentration below of 0.5 (М hBD-2 stimulated, and at the concentrations higher than 0,5 (М – inhibited proliferation of cultured epithelial cells. The reverse relation between hBD-2 concentration and its influence on the level of phosphorylation of EGF receptor in vitro was shown. At the concentrations lower than 0.5 (М, hBD-2 stimulates phosphorylation of EGF receptor with the following activation of MEK1/2 and ERK1/2 kinases. By RT-PCR analysis and immunohistochemistry with the use of anti-hBD-2-monoclonal antibodies it was demonstrated that 65% of gastric tumors are characterized by the presence of expression of beta-defensin-2 on mRNA and protein levels. With the use of semiquantitive analysis it was shown that the cells of cervical squamous cell carcinoma at stages T0 and T1A are characterized by hyperexpression of hBD-2 compared to untransformed cervical epithelium. Key words: beta-defensin-2, hBD-2 gene, epidermal growth factor receptor, proliferation, monoclonal antibody, gastric cancer, cervical cancer. 45 кДа 31 кДа 21 кДа 14 кДа 6 кДа 99 кДа 66 кДа 45 кДа 31 кДа 21 кДа 14 кДа hBD-2 М GST-hBD-2 GST М p-MEK1/2 p-ERK1/2

Добавить комментарий

Ваш e-mail не будет опубликован. Обязательные поля помечены *